Mutagenetix > Incidental Mutation

Incidental Mutation 'R2398:Cog2'

248600

Institutional Source

Beutler Lab

Gene Symbol

Cog2

Ensembl Gene

ENSMUSG00000031979

Gene Name

component of oligomeric golgi complex 2

Synonyms

2700012E02Rik, 1190002B08Rik, Cog2

MMRRC Submission

040365-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2398 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

124520767-124552008 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 124529926 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 137 (I137T)

Ref Sequence

ENSEMBL: ENSMUSP00000034460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034460] [ENSMUST00000176159] [ENSMUST00000176279]

AlphaFold

Q921L5

Predicted Effect

probably benign
Transcript: ENSMUST00000034460
AA Change: I137T

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000034460
Gene: ENSMUSG00000031979
AA Change: I137T

Domain	Start	End	E-Value	Type
Pfam:COG2	15	147	1.4e-44	PFAM
low complexity region	207	220	N/A	INTRINSIC
low complexity region	490	502	N/A	INTRINSIC
Pfam:DUF3510	565	692	6.1e-45	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000108803

Predicted Effect

probably benign
Transcript: ENSMUST00000176159

SMART Domains

Protein: ENSMUSP00000135600
Gene: ENSMUSG00000031979

Domain	Start	End	E-Value	Type
low complexity region	25	38	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176279

SMART Domains

Protein: ENSMUSP00000135022
Gene: ENSMUSG00000031979

Domain	Start	End	E-Value	Type
Pfam:COG2	15	101	1.5e-37	PFAM

Meta Mutation Damage Score

0.0588

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 93.4%

Validation Efficiency

100% (39/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi complex. The encoded protein specifically interacts with the USO1 vesicle docking protein and may be necessary for normal Golgi ribbon formation and trafficking of Golgi enzymes. Mutations of this gene are associated with abnormal glycosylation within the Golgi apparatus. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930568D16Rik	T	C	2: 35,354,860	D160G	possibly damaging	Het
Akr1c6	T	C	13: 4,449,036	S208P	probably benign	Het
Ap3b2	A	G	7: 81,477,195	F269S	probably damaging	Het
Ap3d1	G	A	10: 80,719,172	Q440*	probably null	Het
Cse1l	A	G	2: 166,928,997	Y369C	probably damaging	Het
Dnah9	T	C	11: 65,915,203	N3357D	probably damaging	Het
Fam83b	T	C	9: 76,502,218	T209A	probably damaging	Het
Gbp2	G	A	3: 142,633,362	A392T	probably benign	Het
Grsf1	G	A	5: 88,673,836	T123I	probably damaging	Het
Gzmc	T	A	14: 56,232,771	I90F	possibly damaging	Het
Hook2	T	A	8: 84,991,299	N42K	probably damaging	Het
Hsp90aa1	T	C	12: 110,692,321	M629V	possibly damaging	Het
Ifna14	T	C	4: 88,571,626	D58G	possibly damaging	Het
Krtap4-8	T	C	11: 99,780,277		probably benign	Het
Mocs1	T	C	17: 49,452,834	I381T	probably damaging	Het
Nbas	A	G	12: 13,432,945	T1408A	probably damaging	Het
Olfr1057	T	A	2: 86,374,839	D191V	probably damaging	Het
Olfr818	A	G	10: 129,945,207	F285S	probably benign	Het
Orc1	C	T	4: 108,601,969	T445I	possibly damaging	Het
Pdik1l	T	C	4: 134,278,399	K411E	probably benign	Het
Pias3	A	G	3: 96,703,813	I443V	probably benign	Het
Psmd2	T	C	16: 20,659,472	S536P	possibly damaging	Het
Rnf10	C	T	5: 115,247,273	R554H	probably benign	Het
Smarcc2	C	T	10: 128,469,682	T325I	possibly damaging	Het
Smchd1	C	A	17: 71,360,141	C1752F	probably damaging	Het
Smchd1	G	A	17: 71,426,436		probably benign	Het
Svil	A	G	18: 5,060,613		probably null	Het
Tex52	T	C	6: 128,379,577	S78P	probably damaging	Het
Tmem63c	T	G	12: 87,056,533	V27G	probably damaging	Het
Ttc41	A	G	10: 86,713,386	N148S	possibly damaging	Het
Vmn2r67	T	C	7: 85,136,713	I695V	probably damaging	Het
Wipf2	T	A	11: 98,898,717		probably null	Het
Zc3h18	A	G	8: 122,413,866		probably benign	Het
Zfp804a	T	A	2: 82,258,669	N947K	possibly damaging	Het
Zfyve26	T	C	12: 79,282,799		probably null	Het
Zic2	G	T	14: 122,478,917	E422*	probably null	Het
Zmym4	A	T	4: 126,923,136	D4E	probably damaging	Het

Other mutations in Cog2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01089:Cog2	APN	8	124545243	missense	probably benign	0.00
IGL01092:Cog2	APN	8	124545280	missense	probably damaging	1.00
IGL01150:Cog2	APN	8	124542891	missense	possibly damaging	0.62
IGL02052:Cog2	APN	8	124542888	critical splice acceptor site	probably null
IGL02308:Cog2	APN	8	124533212	critical splice acceptor site	probably null
IGL02543:Cog2	APN	8	124529959	missense	probably benign	0.09
IGL02978:Cog2	APN	8	124550336	missense	probably benign
IGL03008:Cog2	APN	8	124535392	splice site	probably benign
IGL03144:Cog2	APN	8	124541024	missense	probably damaging	0.98
kugge	UTSW	8	124550232	missense	probably damaging	1.00
Pelota	UTSW	8	124550306	missense	probably damaging	1.00
PIT4677001:Cog2	UTSW	8	124545271	missense	probably benign	0.22
R0071:Cog2	UTSW	8	124548668	splice site	probably benign
R0071:Cog2	UTSW	8	124548668	splice site	probably benign
R0110:Cog2	UTSW	8	124529058	critical splice donor site	probably null
R0436:Cog2	UTSW	8	124548514	splice site	probably benign
R0450:Cog2	UTSW	8	124529058	critical splice donor site	probably null
R1365:Cog2	UTSW	8	124540974	missense	probably damaging	0.97
R1661:Cog2	UTSW	8	124542890	missense	probably benign	0.20
R1698:Cog2	UTSW	8	124525683	missense	probably damaging	1.00
R1856:Cog2	UTSW	8	124551403	missense	possibly damaging	0.93
R2122:Cog2	UTSW	8	124528985	missense	possibly damaging	0.91
R3855:Cog2	UTSW	8	124530003	critical splice donor site	probably null
R4580:Cog2	UTSW	8	124545136	missense	probably benign	0.01
R4803:Cog2	UTSW	8	124535451	missense	probably damaging	0.96
R5316:Cog2	UTSW	8	124529040	missense	probably benign	0.14
R5346:Cog2	UTSW	8	124546631	missense	possibly damaging	0.94
R5394:Cog2	UTSW	8	124532529	missense	probably benign	0.00
R5395:Cog2	UTSW	8	124545221	missense	probably benign	0.00
R5738:Cog2	UTSW	8	124546038	missense	probably benign	0.03
R5861:Cog2	UTSW	8	124537878	missense	probably damaging	1.00
R5894:Cog2	UTSW	8	124545267	missense	probably benign	0.00
R5941:Cog2	UTSW	8	124546086	missense	probably benign
R6186:Cog2	UTSW	8	124546686	missense	probably damaging	1.00
R6400:Cog2	UTSW	8	124550306	missense	probably damaging	1.00
R6518:Cog2	UTSW	8	124527103	nonsense	probably null
R6558:Cog2	UTSW	8	124550232	missense	probably damaging	1.00
R6717:Cog2	UTSW	8	124525749	missense	probably damaging	1.00
R6902:Cog2	UTSW	8	124546691	missense	probably damaging	1.00
R6914:Cog2	UTSW	8	124545136	missense	probably benign	0.00
R6942:Cog2	UTSW	8	124545136	missense	probably benign	0.00
R7103:Cog2	UTSW	8	124541114	critical splice donor site	probably null
R7274:Cog2	UTSW	8	124535519	missense	possibly damaging	0.71
R7641:Cog2	UTSW	8	124537882	missense	probably damaging	0.96
R7674:Cog2	UTSW	8	124537882	missense	probably damaging	0.96
R8559:Cog2	UTSW	8	124542908	missense	probably benign	0.25
R9190:Cog2	UTSW	8	124533319	missense	probably damaging	1.00
R9307:Cog2	UTSW	8	124527098	critical splice acceptor site	probably null
R9629:Cog2	UTSW	8	124533386	missense	possibly damaging	0.67
X0026:Cog2	UTSW	8	124546020	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- CCTTGGGAATTGAGGATTACGC -3'
(R):5'- ACAAATGCTGGCCTCACAG -3'

Sequencing Primer
(F):5'- CAGCCTGATAAGTGTTCC -3'
(R):5'- GGCTGAGCCGCTTTTAAACTAGAC -3'

Posted On

2014-11-11