Mutagenetix > Incidental Mutation

Incidental Mutation 'R2398:Ap3d1'

248602

Institutional Source

Beutler Lab

Gene Symbol

Ap3d1

Ensembl Gene

ENSMUSG00000020198

Gene Name

adaptor-related protein complex 3, delta 1 subunit

Synonyms

mBLVR1, Bolvr

MMRRC Submission

040365-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.931) question?

Stock #

R2398 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

80542790-80578098 bp(-) (GRCm39)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 80555006 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 440 (Q440*)

Ref Sequence

ENSEMBL: ENSMUSP00000020420 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020420]

AlphaFold

O54774

Predicted Effect

probably null
Transcript: ENSMUST00000020420
AA Change: Q440*

SMART Domains

Protein: ENSMUSP00000020420
Gene: ENSMUSG00000020198
AA Change: Q440*

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	32	583	6.6e-153	PFAM
Pfam:Cnd1	130	292	2.1e-8	PFAM
low complexity region	629	642	N/A	INTRINSIC
BLVR	660	803	5.3e-80	SMART
low complexity region	835	861	N/A	INTRINSIC
low complexity region	871	881	N/A	INTRINSIC
coiled coil region	910	933	N/A	INTRINSIC
low complexity region	947	964	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218125

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219253

Predicted Effect

probably benign
Transcript: ENSMUST00000219356

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220183

Meta Mutation Damage Score

0.9754

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 93.4%

Validation Efficiency

100% (39/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the AP3 adaptor-like complex, which is not clathrin-associated, but is associated with the golgi region, as well as more peripheral structures. The AP-3 complex facilitates the budding of vesicles from the golgi membrane, and may be directly involved in trafficking to lysosomes. This subunit is implicated in intracellular biogenesis and trafficking of pigment granules, and possibly platelet dense granules and neurotransmitter vesicles. Defects in this gene are a cause of a new type of Hermansky-Pudlak syndrome. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mutant mice show coat and eye color dilution, platelet defects, lysosomal abnormalities, inner ear degeneration and neurological defects and model Hermansky-Pudlak storage pool deficiency syndrome. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930568D16Rik	T	C	2: 35,244,872 (GRCm39)	D160G	possibly damaging	Het
Akr1c6	T	C	13: 4,499,035 (GRCm39)	S208P	probably benign	Het
Ap3b2	A	G	7: 81,126,943 (GRCm39)	F269S	probably damaging	Het
Cog2	T	C	8: 125,256,665 (GRCm39)	I137T	probably benign	Het
Cse1l	A	G	2: 166,770,917 (GRCm39)	Y369C	probably damaging	Het
Dnah9	T	C	11: 65,806,029 (GRCm39)	N3357D	probably damaging	Het
Fam83b	T	C	9: 76,409,500 (GRCm39)	T209A	probably damaging	Het
Gbp2	G	A	3: 142,339,123 (GRCm39)	A392T	probably benign	Het
Grsf1	G	A	5: 88,821,695 (GRCm39)	T123I	probably damaging	Het
Gzmc	T	A	14: 56,470,228 (GRCm39)	I90F	possibly damaging	Het
Hook2	T	A	8: 85,717,928 (GRCm39)	N42K	probably damaging	Het
Hsp90aa1	T	C	12: 110,658,755 (GRCm39)	M629V	possibly damaging	Het
Ifna14	T	C	4: 88,489,863 (GRCm39)	D58G	possibly damaging	Het
Krtap4-8	T	C	11: 99,671,103 (GRCm39)		probably benign	Het
Mocs1	T	C	17: 49,759,862 (GRCm39)	I381T	probably damaging	Het
Nbas	A	G	12: 13,482,946 (GRCm39)	T1408A	probably damaging	Het
Or6c219	A	G	10: 129,781,076 (GRCm39)	F285S	probably benign	Het
Or8j3b	T	A	2: 86,205,183 (GRCm39)	D191V	probably damaging	Het
Orc1	C	T	4: 108,459,166 (GRCm39)	T445I	possibly damaging	Het
Pdik1l	T	C	4: 134,005,710 (GRCm39)	K411E	probably benign	Het
Pias3	A	G	3: 96,611,129 (GRCm39)	I443V	probably benign	Het
Psmd2	T	C	16: 20,478,222 (GRCm39)	S536P	possibly damaging	Het
Rnf10	C	T	5: 115,385,332 (GRCm39)	R554H	probably benign	Het
Smarcc2	C	T	10: 128,305,551 (GRCm39)	T325I	possibly damaging	Het
Smchd1	C	A	17: 71,667,136 (GRCm39)	C1752F	probably damaging	Het
Smchd1	G	A	17: 71,733,431 (GRCm39)		probably benign	Het
Svil	A	G	18: 5,060,613 (GRCm39)		probably null	Het
Tex52	T	C	6: 128,356,540 (GRCm39)	S78P	probably damaging	Het
Tmem63c	T	G	12: 87,103,307 (GRCm39)	V27G	probably damaging	Het
Ttc41	A	G	10: 86,549,250 (GRCm39)	N148S	possibly damaging	Het
Vmn2r67	T	C	7: 84,785,921 (GRCm39)	I695V	probably damaging	Het
Wipf2	T	A	11: 98,789,543 (GRCm39)		probably null	Het
Zc3h18	A	G	8: 123,140,605 (GRCm39)		probably benign	Het
Zfp804a	T	A	2: 82,089,013 (GRCm39)	N947K	possibly damaging	Het
Zfyve26	T	C	12: 79,329,573 (GRCm39)		probably null	Het
Zic2	G	T	14: 122,716,329 (GRCm39)	E422*	probably null	Het
Zmym4	A	T	4: 126,816,929 (GRCm39)	D4E	probably damaging	Het

Other mutations in Ap3d1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Ap3d1	APN	10	80,577,813 (GRCm39)	missense	probably benign	0.00
IGL00827:Ap3d1	APN	10	80,549,393 (GRCm39)	missense	possibly damaging	0.92
IGL01668:Ap3d1	APN	10	80,554,993 (GRCm39)	missense	possibly damaging	0.95
IGL01934:Ap3d1	APN	10	80,545,092 (GRCm39)	nonsense	probably null
IGL03404:Ap3d1	APN	10	80,565,871 (GRCm39)	missense	probably damaging	1.00
christian	UTSW	10	80,565,876 (GRCm39)	missense	probably damaging	1.00
Particle	UTSW	10	80,546,328 (GRCm39)	splice site	probably null
vesicle	UTSW	10	80,559,661 (GRCm39)	missense	probably damaging	1.00
R0119:Ap3d1	UTSW	10	80,559,449 (GRCm39)	splice site	probably benign
R0197:Ap3d1	UTSW	10	80,565,876 (GRCm39)	missense	probably damaging	1.00
R0356:Ap3d1	UTSW	10	80,563,812 (GRCm39)	missense	probably damaging	1.00
R0372:Ap3d1	UTSW	10	80,559,401 (GRCm39)	missense	probably damaging	1.00
R0491:Ap3d1	UTSW	10	80,555,075 (GRCm39)	missense	probably damaging	1.00
R0636:Ap3d1	UTSW	10	80,555,216 (GRCm39)	nonsense	probably null
R0792:Ap3d1	UTSW	10	80,544,313 (GRCm39)	missense	probably benign
R0942:Ap3d1	UTSW	10	80,568,789 (GRCm39)	splice site	probably benign
R1015:Ap3d1	UTSW	10	80,552,323 (GRCm39)	missense	probably damaging	1.00
R1023:Ap3d1	UTSW	10	80,550,092 (GRCm39)	missense	probably damaging	1.00
R1170:Ap3d1	UTSW	10	80,568,674 (GRCm39)	splice site	probably benign
R1540:Ap3d1	UTSW	10	80,551,775 (GRCm39)	missense	probably benign	0.00
R1639:Ap3d1	UTSW	10	80,565,844 (GRCm39)	missense	probably damaging	0.98
R1664:Ap3d1	UTSW	10	80,553,571 (GRCm39)	nonsense	probably null
R1669:Ap3d1	UTSW	10	80,546,670 (GRCm39)	unclassified	probably benign
R1839:Ap3d1	UTSW	10	80,562,942 (GRCm39)	missense	probably damaging	1.00
R1940:Ap3d1	UTSW	10	80,545,607 (GRCm39)	missense	probably benign	0.03
R2081:Ap3d1	UTSW	10	80,568,770 (GRCm39)	missense	probably damaging	1.00
R2258:Ap3d1	UTSW	10	80,556,966 (GRCm39)	missense	probably benign	0.03
R2281:Ap3d1	UTSW	10	80,549,832 (GRCm39)	missense	probably damaging	0.96
R2849:Ap3d1	UTSW	10	80,577,742 (GRCm39)	missense	possibly damaging	0.65
R3856:Ap3d1	UTSW	10	80,548,019 (GRCm39)	missense	probably benign
R4350:Ap3d1	UTSW	10	80,555,119 (GRCm39)	missense	probably benign	0.15
R4590:Ap3d1	UTSW	10	80,555,646 (GRCm39)	nonsense	probably null
R4782:Ap3d1	UTSW	10	80,557,420 (GRCm39)	splice site	probably null
R4785:Ap3d1	UTSW	10	80,548,612 (GRCm39)	frame shift	probably null
R4834:Ap3d1	UTSW	10	80,555,560 (GRCm39)	missense	probably damaging	1.00
R4864:Ap3d1	UTSW	10	80,548,612 (GRCm39)	frame shift	probably null
R5051:Ap3d1	UTSW	10	80,555,033 (GRCm39)	missense	probably damaging	1.00
R5109:Ap3d1	UTSW	10	80,545,284 (GRCm39)	missense	probably benign	0.11
R5219:Ap3d1	UTSW	10	80,545,651 (GRCm39)	missense	probably benign	0.03
R5220:Ap3d1	UTSW	10	80,563,001 (GRCm39)	missense	probably damaging	1.00
R5307:Ap3d1	UTSW	10	80,559,383 (GRCm39)	missense	probably benign	0.29
R5586:Ap3d1	UTSW	10	80,554,964 (GRCm39)	missense	possibly damaging	0.92
R5796:Ap3d1	UTSW	10	80,549,871 (GRCm39)	missense	possibly damaging	0.70
R5905:Ap3d1	UTSW	10	80,558,761 (GRCm39)	missense	possibly damaging	0.50
R6025:Ap3d1	UTSW	10	80,546,298 (GRCm39)	missense	probably benign	0.01
R6028:Ap3d1	UTSW	10	80,558,761 (GRCm39)	missense	possibly damaging	0.50
R6364:Ap3d1	UTSW	10	80,546,328 (GRCm39)	splice site	probably null
R6469:Ap3d1	UTSW	10	80,547,992 (GRCm39)	missense	probably benign
R6603:Ap3d1	UTSW	10	80,549,881 (GRCm39)	missense	probably benign	0.04
R6872:Ap3d1	UTSW	10	80,550,156 (GRCm39)	nonsense	probably null
R6887:Ap3d1	UTSW	10	80,559,532 (GRCm39)	missense	probably damaging	1.00
R7249:Ap3d1	UTSW	10	80,577,767 (GRCm39)	missense	probably damaging	1.00
R7316:Ap3d1	UTSW	10	80,553,693 (GRCm39)	missense	probably damaging	1.00
R7325:Ap3d1	UTSW	10	80,559,637 (GRCm39)	missense	probably damaging	1.00
R7395:Ap3d1	UTSW	10	80,566,716 (GRCm39)	missense	probably benign	0.11
R7405:Ap3d1	UTSW	10	80,577,734 (GRCm39)	missense	probably benign	0.16
R7425:Ap3d1	UTSW	10	80,557,426 (GRCm39)	missense	probably damaging	1.00
R7558:Ap3d1	UTSW	10	80,558,755 (GRCm39)	missense	possibly damaging	0.92
R7583:Ap3d1	UTSW	10	80,545,292 (GRCm39)	missense	probably benign	0.13
R7703:Ap3d1	UTSW	10	80,553,678 (GRCm39)	missense	probably damaging	1.00
R7964:Ap3d1	UTSW	10	80,565,891 (GRCm39)	missense	probably damaging	1.00
R8021:Ap3d1	UTSW	10	80,550,135 (GRCm39)	missense	probably benign	0.30
R8200:Ap3d1	UTSW	10	80,558,766 (GRCm39)	nonsense	probably null
R8314:Ap3d1	UTSW	10	80,559,373 (GRCm39)	missense	possibly damaging	0.91
R8356:Ap3d1	UTSW	10	80,568,737 (GRCm39)	missense	probably damaging	1.00
R8896:Ap3d1	UTSW	10	80,552,425 (GRCm39)	missense	probably benign	0.01
R8936:Ap3d1	UTSW	10	80,547,952 (GRCm39)	missense	probably benign	0.02
R9183:Ap3d1	UTSW	10	80,545,627 (GRCm39)	missense	probably null	0.06
R9209:Ap3d1	UTSW	10	80,554,918 (GRCm39)	missense	probably benign	0.04
R9259:Ap3d1	UTSW	10	80,559,661 (GRCm39)	missense	probably damaging	1.00
R9476:Ap3d1	UTSW	10	80,545,655 (GRCm39)	missense	probably benign	0.00
R9645:Ap3d1	UTSW	10	80,545,062 (GRCm39)	missense	probably benign
R9664:Ap3d1	UTSW	10	80,548,639 (GRCm39)	missense	possibly damaging	0.71
R9781:Ap3d1	UTSW	10	80,545,609 (GRCm39)	missense	possibly damaging	0.51
X0019:Ap3d1	UTSW	10	80,554,936 (GRCm39)	missense	probably damaging	1.00
X0026:Ap3d1	UTSW	10	80,556,981 (GRCm39)	missense	possibly damaging	0.46
Z1088:Ap3d1	UTSW	10	80,555,071 (GRCm39)	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- GATCTGTCTGCGTACATGTCCC -3'
(R):5'- TCATGACTCACGTGGACAAG -3'

Sequencing Primer
(F):5'- ACTAGGCCACTTCCAAGGG -3'
(R):5'- CTCACGTGGACAAGGCTGAG -3'

Posted On

2014-11-11