Incidental Mutation 'R2398:Olfr818'
ID248605
Institutional Source Beutler Lab
Gene Symbol Olfr818
Ensembl Gene ENSMUSG00000058071
Gene Nameolfactory receptor 818
SynonymsGA_x6K02T2PULF-11624146-11623190, MOR110-2
MMRRC Submission 040365-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R2398 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129944396-129949100 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129945207 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 285 (F285S)
Ref Sequence ENSEMBL: ENSMUSP00000149259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074308] [ENSMUST00000205227] [ENSMUST00000215527]
Predicted Effect probably benign
Transcript: ENSMUST00000074308
AA Change: F285S

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000073918
Gene: ENSMUSG00000058071
AA Change: F285S

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.4e-47 PFAM
Pfam:7tm_1 39 287 3.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205227
SMART Domains Protein: ENSMUSP00000145108
Gene: ENSMUSG00000058071

DomainStartEndE-ValueType
Pfam:7tm_1 1 122 5e-13 PFAM
Pfam:7tm_4 1 123 8.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215527
AA Change: F285S

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T C 2: 35,354,860 D160G possibly damaging Het
Akr1c6 T C 13: 4,449,036 S208P probably benign Het
Ap3b2 A G 7: 81,477,195 F269S probably damaging Het
Ap3d1 G A 10: 80,719,172 Q440* probably null Het
Cog2 T C 8: 124,529,926 I137T probably benign Het
Cse1l A G 2: 166,928,997 Y369C probably damaging Het
Dnah9 T C 11: 65,915,203 N3357D probably damaging Het
Fam83b T C 9: 76,502,218 T209A probably damaging Het
Gbp2 G A 3: 142,633,362 A392T probably benign Het
Grsf1 G A 5: 88,673,836 T123I probably damaging Het
Gzmc T A 14: 56,232,771 I90F possibly damaging Het
Hook2 T A 8: 84,991,299 N42K probably damaging Het
Hsp90aa1 T C 12: 110,692,321 M629V possibly damaging Het
Ifna14 T C 4: 88,571,626 D58G possibly damaging Het
Krtap4-8 T C 11: 99,780,277 probably benign Het
Mocs1 T C 17: 49,452,834 I381T probably damaging Het
Nbas A G 12: 13,432,945 T1408A probably damaging Het
Olfr1057 T A 2: 86,374,839 D191V probably damaging Het
Orc1 C T 4: 108,601,969 T445I possibly damaging Het
Pdik1l T C 4: 134,278,399 K411E probably benign Het
Pias3 A G 3: 96,703,813 I443V probably benign Het
Psmd2 T C 16: 20,659,472 S536P possibly damaging Het
Rnf10 C T 5: 115,247,273 R554H probably benign Het
Smarcc2 C T 10: 128,469,682 T325I possibly damaging Het
Smchd1 C A 17: 71,360,141 C1752F probably damaging Het
Smchd1 G A 17: 71,426,436 probably benign Het
Svil A G 18: 5,060,613 probably null Het
Tex52 T C 6: 128,379,577 S78P probably damaging Het
Tmem63c T G 12: 87,056,533 V27G probably damaging Het
Ttc41 A G 10: 86,713,386 N148S possibly damaging Het
Vmn2r67 T C 7: 85,136,713 I695V probably damaging Het
Wipf2 T A 11: 98,898,717 probably null Het
Zc3h18 A G 8: 122,413,866 probably benign Het
Zfp804a T A 2: 82,258,669 N947K possibly damaging Het
Zfyve26 T C 12: 79,282,799 probably null Het
Zic2 G T 14: 122,478,917 E422* probably null Het
Zmym4 A T 4: 126,923,136 D4E probably damaging Het
Other mutations in Olfr818
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Olfr818 APN 10 129945911 missense possibly damaging 0.95
IGL00951:Olfr818 APN 10 129945712 missense probably damaging 0.99
IGL01700:Olfr818 APN 10 129945941 missense probably damaging 1.00
IGL02313:Olfr818 APN 10 129945903 missense probably damaging 1.00
IGL02373:Olfr818 APN 10 129945465 missense probably benign 0.11
IGL02983:Olfr818 APN 10 129945189 missense probably damaging 1.00
R0730:Olfr818 UTSW 10 129945111 missense probably benign 0.04
R1574:Olfr818 UTSW 10 129945510 missense probably damaging 1.00
R1574:Olfr818 UTSW 10 129945510 missense probably damaging 1.00
R1789:Olfr818 UTSW 10 129945582 nonsense probably null
R1824:Olfr818 UTSW 10 129945337 missense possibly damaging 0.67
R2107:Olfr818 UTSW 10 129945712 missense probably damaging 0.99
R5799:Olfr818 UTSW 10 129945911 missense possibly damaging 0.95
R6048:Olfr818 UTSW 10 129945826 missense possibly damaging 0.67
R7027:Olfr818 UTSW 10 129945172 missense possibly damaging 0.60
R7222:Olfr818 UTSW 10 129945889 missense probably damaging 1.00
R7406:Olfr818 UTSW 10 129945566 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCACCTCTCAGTTAAGAAGATGTAC -3'
(R):5'- TCCCTTCAGCTCAACAAAGG -3'

Sequencing Primer
(F):5'- GAGAAACACTCACATAGGCTTAGC -3'
(R):5'- GTTAAAACCTCAGCCAAGG -3'
Posted On2014-11-11