Mutagenetix > Incidental Mutation

Incidental Mutation 'R2398:Zfyve26'

248610

Institutional Source

Beutler Lab

Gene Symbol

Zfyve26

Ensembl Gene

ENSMUSG00000066440

Gene Name

zinc finger, FYVE domain containing 26

Synonyms

A630028O16Rik, 9330197E15Rik, LOC380767

MMRRC Submission

040365-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2398 (G1)

Quality Score

188

Status

Validated

Chromosome

Chromosomal Location

79279120-79343078 bp(-) (GRCm39)

Type of Mutation

splice site (3 bp from exon)

DNA Base Change (assembly)

T to C at 79329573 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000151280 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021547] [ENSMUST00000218377]

AlphaFold

Q5DU37

Predicted Effect

probably null
Transcript: ENSMUST00000021547

SMART Domains

Protein: ENSMUSP00000021547
Gene: ENSMUSG00000066440

Domain	Start	End	E-Value	Type
low complexity region	8	24	N/A	INTRINSIC
low complexity region	233	244	N/A	INTRINSIC
low complexity region	752	775	N/A	INTRINSIC
low complexity region	778	796	N/A	INTRINSIC
low complexity region	982	1001	N/A	INTRINSIC
low complexity region	1073	1091	N/A	INTRINSIC
low complexity region	1104	1115	N/A	INTRINSIC
low complexity region	1151	1163	N/A	INTRINSIC
low complexity region	1177	1192	N/A	INTRINSIC
low complexity region	1228	1241	N/A	INTRINSIC
low complexity region	1565	1584	N/A	INTRINSIC
low complexity region	1743	1770	N/A	INTRINSIC
FYVE	1794	1863	1.49e-27	SMART
low complexity region	2486	2498	N/A	INTRINSIC
low complexity region	2517	2528	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000218377

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219842

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 93.4%

Validation Efficiency

100% (39/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a FYVE zinc finger binding domain. The presence of this domain is thought to target these proteins to membrane lipids through interaction with phospholipids in the membrane. Mutations in this gene are associated with autosomal recessive spastic paraplegia-15. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygoys for a null allele display a late-onset spastic gait disorder with cerebellar ataxia, axon degeneration, and progressive loss of cortical motoneurons and Purkinje cells preceded by accumulation of autofluorescent, electron-dense, membrane-enclosed material in lysosomal structures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930568D16Rik	T	C	2: 35,244,872 (GRCm39)	D160G	possibly damaging	Het
Akr1c6	T	C	13: 4,499,035 (GRCm39)	S208P	probably benign	Het
Ap3b2	A	G	7: 81,126,943 (GRCm39)	F269S	probably damaging	Het
Ap3d1	G	A	10: 80,555,006 (GRCm39)	Q440*	probably null	Het
Cog2	T	C	8: 125,256,665 (GRCm39)	I137T	probably benign	Het
Cse1l	A	G	2: 166,770,917 (GRCm39)	Y369C	probably damaging	Het
Dnah9	T	C	11: 65,806,029 (GRCm39)	N3357D	probably damaging	Het
Fam83b	T	C	9: 76,409,500 (GRCm39)	T209A	probably damaging	Het
Gbp2	G	A	3: 142,339,123 (GRCm39)	A392T	probably benign	Het
Grsf1	G	A	5: 88,821,695 (GRCm39)	T123I	probably damaging	Het
Gzmc	T	A	14: 56,470,228 (GRCm39)	I90F	possibly damaging	Het
Hook2	T	A	8: 85,717,928 (GRCm39)	N42K	probably damaging	Het
Hsp90aa1	T	C	12: 110,658,755 (GRCm39)	M629V	possibly damaging	Het
Ifna14	T	C	4: 88,489,863 (GRCm39)	D58G	possibly damaging	Het
Krtap4-8	T	C	11: 99,671,103 (GRCm39)		probably benign	Het
Mocs1	T	C	17: 49,759,862 (GRCm39)	I381T	probably damaging	Het
Nbas	A	G	12: 13,482,946 (GRCm39)	T1408A	probably damaging	Het
Or6c219	A	G	10: 129,781,076 (GRCm39)	F285S	probably benign	Het
Or8j3b	T	A	2: 86,205,183 (GRCm39)	D191V	probably damaging	Het
Orc1	C	T	4: 108,459,166 (GRCm39)	T445I	possibly damaging	Het
Pdik1l	T	C	4: 134,005,710 (GRCm39)	K411E	probably benign	Het
Pias3	A	G	3: 96,611,129 (GRCm39)	I443V	probably benign	Het
Psmd2	T	C	16: 20,478,222 (GRCm39)	S536P	possibly damaging	Het
Rnf10	C	T	5: 115,385,332 (GRCm39)	R554H	probably benign	Het
Smarcc2	C	T	10: 128,305,551 (GRCm39)	T325I	possibly damaging	Het
Smchd1	C	A	17: 71,667,136 (GRCm39)	C1752F	probably damaging	Het
Smchd1	G	A	17: 71,733,431 (GRCm39)		probably benign	Het
Svil	A	G	18: 5,060,613 (GRCm39)		probably null	Het
Tex52	T	C	6: 128,356,540 (GRCm39)	S78P	probably damaging	Het
Tmem63c	T	G	12: 87,103,307 (GRCm39)	V27G	probably damaging	Het
Ttc41	A	G	10: 86,549,250 (GRCm39)	N148S	possibly damaging	Het
Vmn2r67	T	C	7: 84,785,921 (GRCm39)	I695V	probably damaging	Het
Wipf2	T	A	11: 98,789,543 (GRCm39)		probably null	Het
Zc3h18	A	G	8: 123,140,605 (GRCm39)		probably benign	Het
Zfp804a	T	A	2: 82,089,013 (GRCm39)	N947K	possibly damaging	Het
Zic2	G	T	14: 122,716,329 (GRCm39)	E422*	probably null	Het
Zmym4	A	T	4: 126,816,929 (GRCm39)	D4E	probably damaging	Het

Other mutations in Zfyve26

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Zfyve26	APN	12	79,296,234 (GRCm39)	unclassified	probably benign
IGL00940:Zfyve26	APN	12	79,327,674 (GRCm39)	missense	probably benign
IGL01148:Zfyve26	APN	12	79,307,644 (GRCm39)	missense	probably benign	0.01
IGL01347:Zfyve26	APN	12	79,298,957 (GRCm39)	splice site	probably null
IGL01472:Zfyve26	APN	12	79,323,117 (GRCm39)	missense	probably benign	0.01
IGL01490:Zfyve26	APN	12	79,291,147 (GRCm39)	missense	probably damaging	1.00
IGL01516:Zfyve26	APN	12	79,334,625 (GRCm39)	missense	probably benign	0.37
IGL01642:Zfyve26	APN	12	79,308,348 (GRCm39)	splice site	probably null
IGL01689:Zfyve26	APN	12	79,330,827 (GRCm39)	missense	possibly damaging	0.71
IGL01877:Zfyve26	APN	12	79,334,218 (GRCm39)	missense	probably damaging	1.00
IGL01997:Zfyve26	APN	12	79,291,174 (GRCm39)	missense	probably benign	0.00
IGL02077:Zfyve26	APN	12	79,323,169 (GRCm39)	missense	possibly damaging	0.54
IGL02437:Zfyve26	APN	12	79,315,621 (GRCm39)	missense	probably benign	0.01
IGL02933:Zfyve26	APN	12	79,326,854 (GRCm39)	missense	possibly damaging	0.94
IGL02937:Zfyve26	APN	12	79,285,794 (GRCm39)	missense	probably benign	0.08
IGL02982:Zfyve26	APN	12	79,310,644 (GRCm39)	missense	probably damaging	0.99
IGL03064:Zfyve26	APN	12	79,308,565 (GRCm39)	missense	probably damaging	1.00
IGL03086:Zfyve26	APN	12	79,342,338 (GRCm39)	missense	probably damaging	0.96
IGL03146:Zfyve26	APN	12	79,330,846 (GRCm39)	nonsense	probably null
challenge	UTSW	12	79,317,610 (GRCm39)	critical splice donor site	probably null
fourteener	UTSW	12	79,302,037 (GRCm39)	missense	probably damaging	1.00
IGL02799:Zfyve26	UTSW	12	79,320,084 (GRCm39)	missense	probably benign	0.28
R0318:Zfyve26	UTSW	12	79,323,055 (GRCm39)	missense	probably damaging	1.00
R0513:Zfyve26	UTSW	12	79,291,258 (GRCm39)	missense	probably damaging	1.00
R0582:Zfyve26	UTSW	12	79,292,996 (GRCm39)	missense	probably damaging	1.00
R0586:Zfyve26	UTSW	12	79,315,502 (GRCm39)	missense	possibly damaging	0.96
R0718:Zfyve26	UTSW	12	79,312,576 (GRCm39)	splice site	probably benign
R0738:Zfyve26	UTSW	12	79,342,308 (GRCm39)	missense	probably damaging	1.00
R0781:Zfyve26	UTSW	12	79,326,841 (GRCm39)	missense	probably damaging	0.99
R0894:Zfyve26	UTSW	12	79,320,372 (GRCm39)	missense	possibly damaging	0.80
R1109:Zfyve26	UTSW	12	79,318,901 (GRCm39)	missense	probably damaging	1.00
R1110:Zfyve26	UTSW	12	79,326,841 (GRCm39)	missense	probably damaging	0.99
R1186:Zfyve26	UTSW	12	79,310,723 (GRCm39)	missense	probably damaging	1.00
R1295:Zfyve26	UTSW	12	79,321,694 (GRCm39)	missense	probably damaging	1.00
R1430:Zfyve26	UTSW	12	79,329,591 (GRCm39)	missense	probably benign	0.07
R1439:Zfyve26	UTSW	12	79,298,937 (GRCm39)	missense	probably benign	0.03
R1517:Zfyve26	UTSW	12	79,298,925 (GRCm39)	missense	probably damaging	0.98
R1553:Zfyve26	UTSW	12	79,334,535 (GRCm39)	missense	probably benign	0.00
R1721:Zfyve26	UTSW	12	79,308,573 (GRCm39)	missense	possibly damaging	0.94
R1758:Zfyve26	UTSW	12	79,285,718 (GRCm39)	missense	probably damaging	1.00
R1779:Zfyve26	UTSW	12	79,325,237 (GRCm39)	missense	probably damaging	1.00
R1785:Zfyve26	UTSW	12	79,315,208 (GRCm39)	missense	possibly damaging	0.48
R1786:Zfyve26	UTSW	12	79,315,208 (GRCm39)	missense	possibly damaging	0.48
R1826:Zfyve26	UTSW	12	79,315,823 (GRCm39)	missense	probably damaging	1.00
R1833:Zfyve26	UTSW	12	79,333,032 (GRCm39)	missense	probably benign	0.36
R1868:Zfyve26	UTSW	12	79,308,573 (GRCm39)	missense	possibly damaging	0.94
R1900:Zfyve26	UTSW	12	79,311,125 (GRCm39)	missense	probably damaging	1.00
R1928:Zfyve26	UTSW	12	79,286,744 (GRCm39)	nonsense	probably null
R1982:Zfyve26	UTSW	12	79,302,017 (GRCm39)	missense	possibly damaging	0.55
R2062:Zfyve26	UTSW	12	79,330,806 (GRCm39)	splice site	probably null
R2071:Zfyve26	UTSW	12	79,334,220 (GRCm39)	missense	possibly damaging	0.95
R2130:Zfyve26	UTSW	12	79,315,208 (GRCm39)	missense	possibly damaging	0.48
R2132:Zfyve26	UTSW	12	79,315,208 (GRCm39)	missense	possibly damaging	0.48
R2133:Zfyve26	UTSW	12	79,315,208 (GRCm39)	missense	possibly damaging	0.48
R2135:Zfyve26	UTSW	12	79,292,826 (GRCm39)	missense	possibly damaging	0.80
R2207:Zfyve26	UTSW	12	79,292,861 (GRCm39)	missense	probably damaging	0.99
R2280:Zfyve26	UTSW	12	79,321,814 (GRCm39)	missense	probably damaging	1.00
R2352:Zfyve26	UTSW	12	79,330,890 (GRCm39)	missense	probably damaging	1.00
R3084:Zfyve26	UTSW	12	79,312,457 (GRCm39)	splice site	probably benign
R3086:Zfyve26	UTSW	12	79,312,457 (GRCm39)	splice site	probably benign
R4626:Zfyve26	UTSW	12	79,315,844 (GRCm39)	missense	possibly damaging	0.95
R4727:Zfyve26	UTSW	12	79,291,170 (GRCm39)	missense	probably benign	0.16
R4908:Zfyve26	UTSW	12	79,296,469 (GRCm39)	splice site	probably null
R4926:Zfyve26	UTSW	12	79,321,785 (GRCm39)	missense	probably benign
R4990:Zfyve26	UTSW	12	79,334,607 (GRCm39)	missense	probably damaging	1.00
R4999:Zfyve26	UTSW	12	79,327,159 (GRCm39)	nonsense	probably null
R5029:Zfyve26	UTSW	12	79,333,097 (GRCm39)	missense	probably damaging	0.99
R5070:Zfyve26	UTSW	12	79,302,135 (GRCm39)	missense	probably damaging	1.00
R5100:Zfyve26	UTSW	12	79,326,832 (GRCm39)	nonsense	probably null
R5252:Zfyve26	UTSW	12	79,315,756 (GRCm39)	missense	probably damaging	1.00
R5318:Zfyve26	UTSW	12	79,317,624 (GRCm39)	missense	probably benign	0.35
R5509:Zfyve26	UTSW	12	79,293,295 (GRCm39)	missense	probably damaging	1.00
R5574:Zfyve26	UTSW	12	79,286,698 (GRCm39)	missense	possibly damaging	0.63
R5735:Zfyve26	UTSW	12	79,320,147 (GRCm39)	missense	probably damaging	0.96
R5756:Zfyve26	UTSW	12	79,311,131 (GRCm39)	missense	probably damaging	1.00
R5773:Zfyve26	UTSW	12	79,334,511 (GRCm39)	missense	probably damaging	1.00
R5834:Zfyve26	UTSW	12	79,313,311 (GRCm39)	missense	probably benign	0.30
R6075:Zfyve26	UTSW	12	79,340,628 (GRCm39)	missense	possibly damaging	0.74
R6184:Zfyve26	UTSW	12	79,315,501 (GRCm39)	missense	probably damaging	0.98
R6235:Zfyve26	UTSW	12	79,296,373 (GRCm39)	missense	probably damaging	1.00
R6247:Zfyve26	UTSW	12	79,329,758 (GRCm39)	missense	probably benign	0.04
R6320:Zfyve26	UTSW	12	79,286,776 (GRCm39)	missense	probably damaging	0.97
R6548:Zfyve26	UTSW	12	79,285,109 (GRCm39)	missense	probably damaging	1.00
R6887:Zfyve26	UTSW	12	79,313,223 (GRCm39)	missense	probably damaging	1.00
R7133:Zfyve26	UTSW	12	79,330,926 (GRCm39)	missense	probably benign	0.06
R7152:Zfyve26	UTSW	12	79,325,888 (GRCm39)	missense	probably benign	0.42
R7165:Zfyve26	UTSW	12	79,327,179 (GRCm39)	missense	probably damaging	1.00
R7181:Zfyve26	UTSW	12	79,315,182 (GRCm39)	missense	probably benign	0.00
R7223:Zfyve26	UTSW	12	79,292,945 (GRCm39)	missense	probably damaging	0.99
R7296:Zfyve26	UTSW	12	79,325,146 (GRCm39)	splice site	probably null
R7299:Zfyve26	UTSW	12	79,329,758 (GRCm39)	missense	probably benign	0.01
R7301:Zfyve26	UTSW	12	79,329,758 (GRCm39)	missense	probably benign	0.01
R7302:Zfyve26	UTSW	12	79,297,942 (GRCm39)	missense	probably damaging	1.00
R7355:Zfyve26	UTSW	12	79,286,828 (GRCm39)	missense	probably damaging	1.00
R7466:Zfyve26	UTSW	12	79,334,581 (GRCm39)	missense	probably benign	0.00
R7540:Zfyve26	UTSW	12	79,315,450 (GRCm39)	missense	probably damaging	0.99
R7552:Zfyve26	UTSW	12	79,337,731 (GRCm39)	missense	probably damaging	0.97
R7762:Zfyve26	UTSW	12	79,315,409 (GRCm39)	missense	probably benign	0.02
R7806:Zfyve26	UTSW	12	79,327,129 (GRCm39)	critical splice donor site	probably null
R7821:Zfyve26	UTSW	12	79,302,098 (GRCm39)	missense	probably damaging	1.00
R8141:Zfyve26	UTSW	12	79,315,331 (GRCm39)	missense	possibly damaging	0.79
R8190:Zfyve26	UTSW	12	79,327,610 (GRCm39)	missense	probably benign	0.00
R8207:Zfyve26	UTSW	12	79,307,605 (GRCm39)	missense	probably damaging	1.00
R8210:Zfyve26	UTSW	12	79,302,037 (GRCm39)	missense	probably damaging	1.00
R8500:Zfyve26	UTSW	12	79,334,454 (GRCm39)	missense	probably damaging	0.99
R8686:Zfyve26	UTSW	12	79,334,227 (GRCm39)	missense	probably benign
R8758:Zfyve26	UTSW	12	79,311,083 (GRCm39)	critical splice donor site	probably benign
R8826:Zfyve26	UTSW	12	79,285,742 (GRCm39)	missense	probably benign	0.05
R8877:Zfyve26	UTSW	12	79,334,152 (GRCm39)	missense	probably benign	0.05
R9067:Zfyve26	UTSW	12	79,318,915 (GRCm39)	missense	probably damaging	0.99
R9195:Zfyve26	UTSW	12	79,311,168 (GRCm39)	missense	probably benign	0.12
R9269:Zfyve26	UTSW	12	79,323,076 (GRCm39)	missense	possibly damaging	0.73
R9273:Zfyve26	UTSW	12	79,317,610 (GRCm39)	critical splice donor site	probably null
R9340:Zfyve26	UTSW	12	79,321,680 (GRCm39)	nonsense	probably null
R9348:Zfyve26	UTSW	12	79,315,231 (GRCm39)	missense	possibly damaging	0.81
R9482:Zfyve26	UTSW	12	79,291,239 (GRCm39)	missense	probably damaging	1.00
R9536:Zfyve26	UTSW	12	79,298,046 (GRCm39)	missense	probably benign	0.32
R9653:Zfyve26	UTSW	12	79,334,418 (GRCm39)	missense	probably benign
R9676:Zfyve26	UTSW	12	79,330,959 (GRCm39)	missense	probably benign	0.01
R9797:Zfyve26	UTSW	12	79,293,006 (GRCm39)	missense	probably damaging	0.98
RF010:Zfyve26	UTSW	12	79,302,112 (GRCm39)	missense	probably damaging	1.00
X0020:Zfyve26	UTSW	12	79,285,779 (GRCm39)	missense	probably damaging	1.00
Z1176:Zfyve26	UTSW	12	79,315,307 (GRCm39)	missense	probably benign	0.07
Z1177:Zfyve26	UTSW	12	79,334,149 (GRCm39)	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- AGATGATCAGAGTAAGATCCGTC -3'
(R):5'- CGTTTCTATGCTTCAGAGACCC -3'

Sequencing Primer
(F):5'- TCCGTCAAGATGTAAACAGGTC -3'
(R):5'- TGCTTCAGAGACCCATGATG -3'

Posted On

2014-11-11