Incidental Mutation 'R0302:Ttc7b'
ID24863
Institutional Source Beutler Lab
Gene Symbol Ttc7b
Ensembl Gene ENSMUSG00000033530
Gene Nametetratricopeptide repeat domain 7B
SynonymsTtc7l1
MMRRC Submission 038514-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.250) question?
Stock #R0302 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location100300770-100520826 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100387179 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 390 (M390V)
Ref Sequence ENSEMBL: ENSMUSP00000052107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062957] [ENSMUST00000223020]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062957
AA Change: M390V

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000052107
Gene: ENSMUSG00000033530
AA Change: M390V

DomainStartEndE-ValueType
TPR 397 430 8.76e-1 SMART
Blast:TPR 471 514 5e-9 BLAST
TPR 515 548 2.77e1 SMART
TPR 549 582 2.01e0 SMART
TPR 696 729 9.7e0 SMART
TPR 730 763 7.98e-4 SMART
TPR 764 797 6.1e0 SMART
TPR 798 831 2.74e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221975
Predicted Effect possibly damaging
Transcript: ENSMUST00000223020
AA Change: M390V

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223514
Meta Mutation Damage Score 0.1481 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.1%
  • 20x: 89.5%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl2 T C 4: 126,317,392 E244G probably benign Het
Aldh1l2 G A 10: 83,520,365 P54S probably damaging Het
Ankdd1a G A 9: 65,509,642 probably benign Het
Ankra2 T A 13: 98,271,692 S216R probably damaging Het
Asah2 A T 19: 32,052,956 N105K probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Cacna1s A G 1: 136,100,604 Y893C probably benign Het
Capza2 G A 6: 17,648,524 R15H probably benign Het
Cbfa2t2 T C 2: 154,534,876 probably benign Het
Ccdc96 A T 5: 36,486,101 T484S possibly damaging Het
Cckar GCTTAGCCTCTTCT GCT 5: 53,700,299 probably null Het
Ccl4 T A 11: 83,663,454 probably benign Het
Cpt1b A G 15: 89,417,870 Y702H probably benign Het
Cr1l G A 1: 195,117,793 T153I probably damaging Het
Cyth2 C A 7: 45,810,585 E57* probably null Het
Daxx T A 17: 33,913,620 S575T probably damaging Het
Depdc5 T C 5: 32,904,546 probably benign Het
Dnah12 A G 14: 26,799,999 D1923G probably damaging Het
Dnah7b A G 1: 46,123,777 T428A probably benign Het
Dnm2 G T 9: 21,500,343 A619S probably benign Het
Enpp2 T C 15: 54,860,061 T639A probably benign Het
Epsti1 A T 14: 77,939,926 H182L probably damaging Het
Exoc3l C T 8: 105,293,543 R250Q probably benign Het
Ggn G T 7: 29,171,240 probably null Het
Il1rap A G 16: 26,692,794 N196S probably benign Het
Ints6 T C 14: 62,709,512 T335A probably damaging Het
Itga1 G A 13: 115,012,318 probably benign Het
Kifc3 G T 8: 95,103,470 Q557K possibly damaging Het
Krt23 A G 11: 99,478,201 I422T probably benign Het
Lcn2 A G 2: 32,384,889 probably benign Het
Lonp2 A G 8: 86,637,991 T326A possibly damaging Het
Lrpprc T C 17: 84,740,078 I909V possibly damaging Het
Lrrc14 G T 15: 76,714,352 R396L probably benign Het
Lypd6 T G 2: 50,165,667 probably benign Het
Man2b1 A G 8: 85,093,016 N610S probably damaging Het
Map2 A T 1: 66,414,828 N959I probably benign Het
Mctp2 C T 7: 72,090,264 V793I possibly damaging Het
Med25 A C 7: 44,880,558 probably benign Het
Mfsd6 T C 1: 52,709,457 Y83C probably damaging Het
Mtbp A T 15: 55,625,424 M499L probably damaging Het
Mtmr10 A T 7: 64,297,497 K53N probably damaging Het
Nfat5 T C 8: 107,358,701 I542T probably damaging Het
Nr1h3 A G 2: 91,192,013 M90T probably damaging Het
Nsmce4a A G 7: 130,545,893 probably benign Het
Olfr1168 T A 2: 88,185,510 I211N possibly damaging Het
Oprl1 G A 2: 181,719,228 C318Y probably benign Het
Pbx3 A T 2: 34,224,560 S46T probably benign Het
Pign A T 1: 105,589,093 F575I possibly damaging Het
Ptpn13 G T 5: 103,565,225 S1738I probably benign Het
Rnf126 G T 10: 79,759,223 P269Q probably damaging Het
Ryr3 G A 2: 112,647,123 probably benign Het
Slc2a7 C T 4: 150,149,521 A31V probably damaging Het
Slc6a12 A G 6: 121,363,259 D487G probably damaging Het
Son G T 16: 91,656,144 G593V probably damaging Het
Spata31d1a T C 13: 59,703,150 N388S probably benign Het
Spg11 A T 2: 122,092,187 M927K possibly damaging Het
Taf13 A G 3: 108,571,722 M1V probably null Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Trio A G 15: 27,902,517 F286S probably damaging Het
Trpm2 A C 10: 77,943,990 probably benign Het
Vmn1r184 A T 7: 26,267,543 Q238L probably damaging Het
Zfp236 T C 18: 82,658,088 E368G probably damaging Het
Zfr2 G T 10: 81,251,336 probably benign Het
Other mutations in Ttc7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Ttc7b APN 12 100376213 missense probably benign 0.03
IGL01377:Ttc7b APN 12 100355112 missense probably benign 0.21
IGL01617:Ttc7b APN 12 100385956 missense possibly damaging 0.94
IGL02928:Ttc7b APN 12 100403415 missense probably damaging 1.00
IGL03183:Ttc7b APN 12 100373709 splice site probably null
IGL03341:Ttc7b APN 12 100325735 missense possibly damaging 0.66
R0620:Ttc7b UTSW 12 100500073 splice site probably null
R0625:Ttc7b UTSW 12 100355046 missense probably benign 0.04
R1016:Ttc7b UTSW 12 100403358 missense probably null 1.00
R1131:Ttc7b UTSW 12 100382119 critical splice donor site probably null
R1241:Ttc7b UTSW 12 100403439 missense possibly damaging 0.90
R1710:Ttc7b UTSW 12 100403408 missense probably damaging 0.98
R1803:Ttc7b UTSW 12 100407002 missense possibly damaging 0.94
R1887:Ttc7b UTSW 12 100415130 splice site probably null
R1920:Ttc7b UTSW 12 100415130 splice site probably null
R1921:Ttc7b UTSW 12 100415130 splice site probably null
R1922:Ttc7b UTSW 12 100415130 splice site probably null
R2062:Ttc7b UTSW 12 100325689 missense probably damaging 1.00
R2239:Ttc7b UTSW 12 100355001 critical splice donor site probably null
R2380:Ttc7b UTSW 12 100355001 critical splice donor site probably null
R4581:Ttc7b UTSW 12 100500117 missense probably damaging 0.99
R4582:Ttc7b UTSW 12 100500117 missense probably damaging 0.99
R4598:Ttc7b UTSW 12 100500117 missense probably damaging 0.99
R4599:Ttc7b UTSW 12 100500117 missense probably damaging 0.99
R4600:Ttc7b UTSW 12 100500117 missense probably damaging 0.99
R4601:Ttc7b UTSW 12 100500117 missense probably damaging 0.99
R4779:Ttc7b UTSW 12 100403362 missense probably damaging 1.00
R5027:Ttc7b UTSW 12 100301742 missense probably damaging 1.00
R5244:Ttc7b UTSW 12 100348010 missense probably damaging 0.99
R5387:Ttc7b UTSW 12 100446963 missense possibly damaging 0.64
R5739:Ttc7b UTSW 12 100384233 missense probably damaging 1.00
R5997:Ttc7b UTSW 12 100373560 missense probably damaging 0.96
R6223:Ttc7b UTSW 12 100387109 critical splice donor site probably null
R6238:Ttc7b UTSW 12 100495422 missense probably benign 0.31
R6318:Ttc7b UTSW 12 100325677 missense probably damaging 0.99
R6494:Ttc7b UTSW 12 100495407 missense possibly damaging 0.73
R7153:Ttc7b UTSW 12 100355034 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCATGAACAATGCACACGAGTGAG -3'
(R):5'- TTGGTGCTTCTGTGACAGCCTC -3'

Sequencing Primer
(F):5'- GACCCTAAATAAATGTGGTGGTCC -3'
(R):5'- GAGCAAAACTGCTCTCATGTCTG -3'
Posted On2013-04-16