Incidental Mutation 'R2399:Or5b108'
ID 248643
Institutional Source Beutler Lab
Gene Symbol Or5b108
Ensembl Gene ENSMUSG00000094721
Gene Name olfactory receptor family 5 subfamily B member 108
Synonyms GA_x6K02T2RE5P-3517488-3518411, Olfr1462, MOR202-13
Accession Numbers
Essential gene? Probably non essential (E-score: 0.064) question?
Stock # R2399 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 13168033-13168956 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 13168709 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 226 (I226K)
Ref Sequence ENSEMBL: ENSMUSP00000147174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076832] [ENSMUST00000208533]
AlphaFold Q8VFW3
Predicted Effect probably benign
Transcript: ENSMUST00000076832
AA Change: I226K

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000076107
Gene: ENSMUSG00000094721
AA Change: I226K

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.3e-51 PFAM
Pfam:7tm_1 39 288 6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208533
AA Change: I226K

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A G 5: 88,120,338 (GRCm39) E365G probably damaging Het
Abtb1 G A 6: 88,815,720 (GRCm39) T221M possibly damaging Het
Atp2b1 T A 10: 98,835,785 (GRCm39) I510N probably benign Het
Atr T A 9: 95,753,652 (GRCm39) H751Q probably benign Het
Cacna1d T C 14: 29,774,444 (GRCm39) D1650G probably benign Het
Cd93 A G 2: 148,284,071 (GRCm39) I425T probably benign Het
Dpep2 A G 8: 106,716,224 (GRCm39) S135P probably damaging Het
Gm10717 A G 9: 3,025,532 (GRCm39) Y39C probably benign Het
Heatr4 T C 12: 84,027,107 (GRCm39) H50R probably benign Het
Itga6 T C 2: 71,650,358 (GRCm39) Y135H probably damaging Het
Kat6b AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA 14: 21,712,417 (GRCm39) probably benign Het
Myh15 T C 16: 48,957,952 (GRCm39) I923T probably damaging Het
Or7e170 C T 9: 19,795,220 (GRCm39) C127Y probably damaging Het
Or7g16 T A 9: 18,727,323 (GRCm39) D89V probably benign Het
Styxl1 C T 5: 135,776,635 (GRCm39) E318K possibly damaging Het
Tmcc1 C CAT 6: 116,019,831 (GRCm39) probably null Het
Zc3h7a G A 16: 10,965,265 (GRCm39) R623C probably damaging Het
Zfp608 T C 18: 55,030,974 (GRCm39) K989E probably damaging Het
Other mutations in Or5b108
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Or5b108 APN 19 13,168,598 (GRCm39) missense possibly damaging 0.60
IGL01999:Or5b108 APN 19 13,168,924 (GRCm39) missense probably damaging 0.99
IGL02326:Or5b108 APN 19 13,168,779 (GRCm39) nonsense probably null
IGL03381:Or5b108 APN 19 13,168,769 (GRCm39) missense probably damaging 0.98
R1184:Or5b108 UTSW 19 13,168,739 (GRCm39) missense probably damaging 0.99
R1434:Or5b108 UTSW 19 13,168,662 (GRCm39) missense probably benign 0.19
R2161:Or5b108 UTSW 19 13,168,673 (GRCm39) missense probably damaging 0.99
R4583:Or5b108 UTSW 19 13,168,062 (GRCm39) missense probably damaging 1.00
R5937:Or5b108 UTSW 19 13,168,675 (GRCm39) missense probably damaging 1.00
R7164:Or5b108 UTSW 19 13,168,270 (GRCm39) missense probably benign 0.00
R7270:Or5b108 UTSW 19 13,168,768 (GRCm39) missense possibly damaging 0.90
R7645:Or5b108 UTSW 19 13,168,937 (GRCm39) missense probably benign 0.01
R7649:Or5b108 UTSW 19 13,168,136 (GRCm39) missense possibly damaging 0.94
R9713:Or5b108 UTSW 19 13,168,727 (GRCm39) missense probably benign 0.15
R9742:Or5b108 UTSW 19 13,168,769 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAATGCTTCCATCTATACAGTGG -3'
(R):5'- CCAGAGGGTTCAACATAGGG -3'

Sequencing Primer
(F):5'- ACAGTGGATGTATTTAGTCTCTCC -3'
(R):5'- CCAGAGGGTTCAACATAGGGATGAC -3'
Posted On 2014-11-11