Incidental Mutation 'R2399:Olfr1462'
ID248643
Institutional Source Beutler Lab
Gene Symbol Olfr1462
Ensembl Gene ENSMUSG00000094721
Gene Nameolfactory receptor 1462
SynonymsGA_x6K02T2RE5P-3517488-3518411, MOR202-13
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R2399 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location13185734-13193775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13191345 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 226 (I226K)
Ref Sequence ENSEMBL: ENSMUSP00000147174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076832] [ENSMUST00000208533]
Predicted Effect probably benign
Transcript: ENSMUST00000076832
AA Change: I226K

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000076107
Gene: ENSMUSG00000094721
AA Change: I226K

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.3e-51 PFAM
Pfam:7tm_1 39 288 6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208533
AA Change: I226K

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A G 5: 87,972,479 E365G probably damaging Het
Abtb1 G A 6: 88,838,738 T221M possibly damaging Het
Atp2b1 T A 10: 98,999,923 I510N probably benign Het
Atr T A 9: 95,871,599 H751Q probably benign Het
Cacna1d T C 14: 30,052,487 D1650G probably benign Het
Cd93 A G 2: 148,442,151 I425T probably benign Het
Dpep2 A G 8: 105,989,592 S135P probably damaging Het
Gm10717 A G 9: 3,025,532 Y39C probably benign Het
Heatr4 T C 12: 83,980,333 H50R probably benign Het
Itga6 T C 2: 71,820,014 Y135H probably damaging Het
Kat6b AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA 14: 21,662,349 probably benign Het
Myh15 T C 16: 49,137,589 I923T probably damaging Het
Olfr828 T A 9: 18,816,027 D89V probably benign Het
Olfr862 C T 9: 19,883,924 C127Y probably damaging Het
Styxl1 C T 5: 135,747,781 E318K possibly damaging Het
Tmcc1 C CAT 6: 116,042,870 probably null Het
Zc3h7a G A 16: 11,147,401 R623C probably damaging Het
Zfp608 T C 18: 54,897,902 K989E probably damaging Het
Other mutations in Olfr1462
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Olfr1462 APN 19 13191234 missense possibly damaging 0.60
IGL01999:Olfr1462 APN 19 13191560 missense probably damaging 0.99
IGL02326:Olfr1462 APN 19 13191415 nonsense probably null
IGL03381:Olfr1462 APN 19 13191405 missense probably damaging 0.98
R1184:Olfr1462 UTSW 19 13191375 missense probably damaging 0.99
R1434:Olfr1462 UTSW 19 13191298 missense probably benign 0.19
R2161:Olfr1462 UTSW 19 13191309 missense probably damaging 0.99
R4583:Olfr1462 UTSW 19 13190698 missense probably damaging 1.00
R5937:Olfr1462 UTSW 19 13191311 missense probably damaging 1.00
R7164:Olfr1462 UTSW 19 13190906 missense probably benign 0.00
R7270:Olfr1462 UTSW 19 13191404 missense possibly damaging 0.90
R7645:Olfr1462 UTSW 19 13191573 missense probably benign 0.01
R7649:Olfr1462 UTSW 19 13190772 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CTGAATGCTTCCATCTATACAGTGG -3'
(R):5'- CCAGAGGGTTCAACATAGGG -3'

Sequencing Primer
(F):5'- ACAGTGGATGTATTTAGTCTCTCC -3'
(R):5'- CCAGAGGGTTCAACATAGGGATGAC -3'
Posted On2014-11-11