Incidental Mutation 'R2400:Sec62'
ID248647
Institutional Source Beutler Lab
Gene Symbol Sec62
Ensembl Gene ENSMUSG00000027706
Gene NameSEC62 homolog (S. cerevisiae)
Synonyms3100002M17Rik, Dtrp1, Tloc1, HTP1, SEC62
MMRRC Submission 040366-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.824) question?
Stock #R2400 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location30792875-30821263 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30810532 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 182 (N182D)
Ref Sequence ENSEMBL: ENSMUSP00000029256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029256]
Predicted Effect unknown
Transcript: ENSMUST00000029256
AA Change: N182D
SMART Domains Protein: ENSMUSP00000029256
Gene: ENSMUSG00000027706
AA Change: N182D

DomainStartEndE-ValueType
Pfam:Sec62 87 311 1.1e-78 PFAM
low complexity region 338 357 N/A INTRINSIC
low complexity region 376 389 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Sec61 complex is the central component of the protein translocation apparatus of the endoplasmic reticulum (ER) membrane. The protein encoded by this gene and SEC63 protein are found to be associated with ribosome-free SEC61 complex. It is speculated that Sec61-Sec62-Sec63 may perform post-translational protein translocation into the ER. The Sec61-Sec62-Sec63 complex might also perform the backward transport of ER proteins that are subject to the ubiquitin-proteasome-dependent degradation pathway. The encoded protein is an integral membrane protein located in the rough ER. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
7530416G11Rik T C 15: 85,493,365 T133A unknown Het
Adgrl2 G T 3: 148,851,934 S519R probably damaging Het
AU041133 A T 10: 82,150,908 K132* probably null Het
Bhlhe22 A G 3: 18,055,451 N222D probably damaging Het
Cep72 C A 13: 74,048,977 A69S probably damaging Het
Csn1s2a T A 5: 87,780,155 probably null Het
Dapk1 T A 13: 60,752,216 F872I probably benign Het
Dhx57 T C 17: 80,260,416 D746G probably damaging Het
Dnah17 T A 11: 118,126,384 probably null Het
Fgg A G 3: 83,008,187 D37G possibly damaging Het
Fnip2 G T 3: 79,479,634 S958R probably benign Het
Gfpt1 A G 6: 87,087,348 D640G probably damaging Het
Golgb1 C A 16: 36,918,466 T2389K possibly damaging Het
Hmgcl C A 4: 135,952,368 probably null Het
Mmp11 T A 10: 75,925,510 T419S probably benign Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Nkiras1 T A 14: 18,280,011 V108E possibly damaging Het
Pcsk1 T C 13: 75,090,126 L22P probably benign Het
Rnf213 T C 11: 119,443,195 Y3077H probably damaging Het
Serpinb5 A G 1: 106,881,952 T363A probably damaging Het
Usf3 T A 16: 44,215,747 S197T probably benign Het
Vmn2r11 T A 5: 109,052,062 E508D probably benign Het
Wdr81 A G 11: 75,449,035 F1376L probably benign Het
Zfp260 T C 7: 30,104,701 S9P possibly damaging Het
Other mutations in Sec62
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Sec62 APN 3 30810442 splice site probably benign
IGL01359:Sec62 APN 3 30814306 missense unknown
IGL01746:Sec62 APN 3 30814246 missense probably benign 0.39
IGL02437:Sec62 APN 3 30818847 missense unknown
IGL03355:Sec62 APN 3 30809922 missense unknown
R4423:Sec62 UTSW 3 30814282 missense unknown
R4649:Sec62 UTSW 3 30810534 missense unknown
R4717:Sec62 UTSW 3 30809871 missense unknown
R4837:Sec62 UTSW 3 30809869 missense unknown
R5775:Sec62 UTSW 3 30793287 utr 5 prime probably benign
R6153:Sec62 UTSW 3 30810482 missense unknown
R6275:Sec62 UTSW 3 30809836 missense probably damaging 0.98
R6734:Sec62 UTSW 3 30810460 missense probably benign 0.39
R7216:Sec62 UTSW 3 30818829 nonsense probably null
R7250:Sec62 UTSW 3 30812347 missense possibly damaging 0.57
R7453:Sec62 UTSW 3 30809796 intron probably null
Predicted Primers PCR Primer
(F):5'- AGCCATGTGAGATACCTGCC -3'
(R):5'- AGGAAACCTGTGTTGTACTAAGC -3'

Sequencing Primer
(F):5'- CCTGCCATGATTATTTGTAAACACCG -3'
(R):5'- CTGATTCTAACTAGATTAGAAACGT -3'
Posted On2014-11-11