Incidental Mutation 'R2400:Fnip2'
ID248648
Institutional Source Beutler Lab
Gene Symbol Fnip2
Ensembl Gene ENSMUSG00000061175
Gene Namefolliculin interacting protein 2
SynonymsD630023B12Rik
MMRRC Submission 040366-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2400 (G1)
Quality Score194
Status Not validated
Chromosome3
Chromosomal Location79455974-79567796 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 79479634 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 958 (S958R)
Ref Sequence ENSEMBL: ENSMUSP00000115275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076136] [ENSMUST00000133154]
Predicted Effect probably benign
Transcript: ENSMUST00000076136
AA Change: S928R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000075497
Gene: ENSMUSG00000061175
AA Change: S928R

DomainStartEndE-ValueType
Pfam:FNIP_N 42 168 4.3e-39 PFAM
low complexity region 240 261 N/A INTRINSIC
Pfam:FNIP_M 289 528 5.9e-92 PFAM
low complexity region 557 571 N/A INTRINSIC
low complexity region 748 755 N/A INTRINSIC
Pfam:FNIP_C 920 1104 4.1e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133154
AA Change: S958R

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000115275
Gene: ENSMUSG00000061175
AA Change: S958R

DomainStartEndE-ValueType
Pfam:FNIP_N 42 164 5.2e-34 PFAM
low complexity region 270 291 N/A INTRINSIC
Pfam:FNIP_M 323 557 3.9e-93 PFAM
low complexity region 587 601 N/A INTRINSIC
low complexity region 778 785 N/A INTRINSIC
Pfam:FNIP_C 951 1134 2.3e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154645
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the folliculin-interacting protein family. The encoded protein binds to the tumor suppressor folliculin and to AMP-activated protein kinase (AMPK) and be involved in regulating the O6-methylguanine-induced apoptosis signaling pathway. This protein may also play a role cellular metabolism and nutrient sensing by regulating the AMPK-mechanistic target of rapamycin signaling pathway. A homologous binding partner of this protein, folliculin-interacting protein 1, has similar binding activities and may suggest functional redundancy within this protein family. Both folliculin-interacting proteins have also been shown to bind the molecular chaperone heat shock protein-90 (Hsp90) and they may function as a co-chaperones in the stabilization of tumor suppressor folliculin which is a target of Hsp90 chaperone activity. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a null allele have normal lifespans. Mice with combined loss of this gene and a single null allele of Fnip1 develop kidney cancer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
7530416G11Rik T C 15: 85,493,365 T133A unknown Het
Adgrl2 G T 3: 148,851,934 S519R probably damaging Het
AU041133 A T 10: 82,150,908 K132* probably null Het
Bhlhe22 A G 3: 18,055,451 N222D probably damaging Het
Cep72 C A 13: 74,048,977 A69S probably damaging Het
Csn1s2a T A 5: 87,780,155 probably null Het
Dapk1 T A 13: 60,752,216 F872I probably benign Het
Dhx57 T C 17: 80,260,416 D746G probably damaging Het
Dnah17 T A 11: 118,126,384 probably null Het
Fgg A G 3: 83,008,187 D37G possibly damaging Het
Gfpt1 A G 6: 87,087,348 D640G probably damaging Het
Golgb1 C A 16: 36,918,466 T2389K possibly damaging Het
Hmgcl C A 4: 135,952,368 probably null Het
Mmp11 T A 10: 75,925,510 T419S probably benign Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Nkiras1 T A 14: 18,280,011 V108E possibly damaging Het
Pcsk1 T C 13: 75,090,126 L22P probably benign Het
Rnf213 T C 11: 119,443,195 Y3077H probably damaging Het
Sec62 A G 3: 30,810,532 N182D unknown Het
Serpinb5 A G 1: 106,881,952 T363A probably damaging Het
Usf3 T A 16: 44,215,747 S197T probably benign Het
Vmn2r11 T A 5: 109,052,062 E508D probably benign Het
Wdr81 A G 11: 75,449,035 F1376L probably benign Het
Zfp260 T C 7: 30,104,701 S9P possibly damaging Het
Other mutations in Fnip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Fnip2 APN 3 79481521 missense probably benign
IGL00339:Fnip2 APN 3 79515155 missense probably benign 0.12
IGL00340:Fnip2 APN 3 79518061 splice site probably benign
IGL00434:Fnip2 APN 3 79512489 splice site probably benign
IGL01134:Fnip2 APN 3 79512503 nonsense probably null
IGL02732:Fnip2 APN 3 79465697 missense probably damaging 1.00
IGL03327:Fnip2 APN 3 79518081 missense probably damaging 0.98
IGL03402:Fnip2 APN 3 79481276 missense possibly damaging 0.92
R0314:Fnip2 UTSW 3 79481189 missense probably damaging 1.00
R0318:Fnip2 UTSW 3 79512378 missense probably damaging 1.00
R0699:Fnip2 UTSW 3 79481139 missense probably benign 0.00
R1188:Fnip2 UTSW 3 79462162 missense probably damaging 1.00
R1290:Fnip2 UTSW 3 79465693 missense probably damaging 1.00
R1406:Fnip2 UTSW 3 79508091 missense possibly damaging 0.85
R1406:Fnip2 UTSW 3 79508091 missense possibly damaging 0.85
R1535:Fnip2 UTSW 3 79481765 missense probably damaging 1.00
R1618:Fnip2 UTSW 3 79508168 missense possibly damaging 0.70
R1661:Fnip2 UTSW 3 79515149 missense probably benign
R1665:Fnip2 UTSW 3 79515149 missense probably benign
R1965:Fnip2 UTSW 3 79493472 missense probably benign 0.31
R1966:Fnip2 UTSW 3 79493472 missense probably benign 0.31
R1976:Fnip2 UTSW 3 79480931 missense probably benign 0.02
R2004:Fnip2 UTSW 3 79512325 splice site probably benign
R2054:Fnip2 UTSW 3 79572465 unclassified probably benign
R2145:Fnip2 UTSW 3 79500432 missense probably damaging 0.99
R2679:Fnip2 UTSW 3 79480926 missense probably benign 0.13
R3157:Fnip2 UTSW 3 79567594 missense probably damaging 1.00
R3851:Fnip2 UTSW 3 79462157 missense probably damaging 1.00
R3910:Fnip2 UTSW 3 79479505 missense possibly damaging 0.83
R3911:Fnip2 UTSW 3 79479505 missense possibly damaging 0.83
R3912:Fnip2 UTSW 3 79479505 missense possibly damaging 0.83
R4035:Fnip2 UTSW 3 79479501 missense probably benign 0.00
R4166:Fnip2 UTSW 3 79462135 missense probably damaging 1.00
R4537:Fnip2 UTSW 3 79465714 missense probably damaging 0.98
R4732:Fnip2 UTSW 3 79481652 missense probably damaging 1.00
R4733:Fnip2 UTSW 3 79481652 missense probably damaging 1.00
R4774:Fnip2 UTSW 3 79465721 nonsense probably null
R4923:Fnip2 UTSW 3 79489394 critical splice acceptor site probably null
R5043:Fnip2 UTSW 3 79492867 nonsense probably null
R5160:Fnip2 UTSW 3 79488991 missense probably damaging 1.00
R5162:Fnip2 UTSW 3 79481777 missense probably damaging 1.00
R5196:Fnip2 UTSW 3 79572538 unclassified probably benign
R5283:Fnip2 UTSW 3 79465708 missense probably damaging 1.00
R5364:Fnip2 UTSW 3 79481168 missense probably benign 0.00
R5402:Fnip2 UTSW 3 79480943 missense possibly damaging 0.89
R6340:Fnip2 UTSW 3 79507845 missense probably damaging 1.00
R6459:Fnip2 UTSW 3 79481634 missense possibly damaging 0.93
R6592:Fnip2 UTSW 3 79481708 missense probably benign 0.26
R6616:Fnip2 UTSW 3 79480882 missense probably benign 0.00
R6933:Fnip2 UTSW 3 79518111 missense probably benign 0.28
R6962:Fnip2 UTSW 3 79489303 missense probably damaging 1.00
R6971:Fnip2 UTSW 3 79481121 nonsense probably null
R7050:Fnip2 UTSW 3 79506270 missense probably damaging 0.99
R7097:Fnip2 UTSW 3 79481006 missense probably benign
R7315:Fnip2 UTSW 3 79506205 critical splice donor site probably null
R7714:Fnip2 UTSW 3 79518114 missense probably damaging 1.00
R7782:Fnip2 UTSW 3 79508123 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCTCTAAGCTGGTCACTTACG -3'
(R):5'- GGCACCTCCACATCTAGCTTAAG -3'

Sequencing Primer
(F):5'- AAGCTGGTCACTTACGTGCAC -3'
(R):5'- GAGGTTTTGTTTCCACTGTA -3'
Posted On2014-11-11