Incidental Mutation 'R2400:AU041133'
ID248658
Institutional Source Beutler Lab
Gene Symbol AU041133
Ensembl Gene ENSMUSG00000078435
Gene Nameexpressed sequence AU041133
Synonyms
MMRRC Submission 040366-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R2400 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location82128013-82153065 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 82150908 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 132 (K132*)
Ref Sequence ENSEMBL: ENSMUSP00000144661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105314] [ENSMUST00000201286]
Predicted Effect probably null
Transcript: ENSMUST00000105314
AA Change: K131*
SMART Domains Protein: ENSMUSP00000100951
Gene: ENSMUSG00000078435
AA Change: K131*

DomainStartEndE-ValueType
KRAB 3 65 1.77e-15 SMART
ZnF_C2H2 105 127 1.16e-1 SMART
ZnF_C2H2 133 155 3.26e-5 SMART
ZnF_C2H2 161 183 1.26e-2 SMART
ZnF_C2H2 189 211 7.37e-4 SMART
ZnF_C2H2 217 239 3.39e-3 SMART
ZnF_C2H2 245 267 1.26e-2 SMART
ZnF_C2H2 273 295 4.79e-3 SMART
ZnF_C2H2 301 323 6.99e-5 SMART
ZnF_C2H2 329 351 5.9e-3 SMART
ZnF_C2H2 357 379 1.03e-2 SMART
ZnF_C2H2 385 407 6.42e-4 SMART
ZnF_C2H2 413 435 8.94e-3 SMART
ZnF_C2H2 441 463 1.6e-4 SMART
ZnF_C2H2 469 491 5.99e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000201286
AA Change: K132*
SMART Domains Protein: ENSMUSP00000144661
Gene: ENSMUSG00000078435
AA Change: K132*

DomainStartEndE-ValueType
KRAB 4 66 7.7e-18 SMART
ZnF_C2H2 106 128 5e-4 SMART
ZnF_C2H2 134 156 1.4e-7 SMART
ZnF_C2H2 162 184 5.3e-5 SMART
ZnF_C2H2 190 212 3.2e-6 SMART
ZnF_C2H2 218 240 1.4e-5 SMART
ZnF_C2H2 246 268 5.3e-5 SMART
ZnF_C2H2 274 296 2e-5 SMART
ZnF_C2H2 302 324 3.1e-7 SMART
ZnF_C2H2 330 352 2.6e-5 SMART
ZnF_C2H2 358 380 4.5e-5 SMART
ZnF_C2H2 386 408 2.8e-6 SMART
ZnF_C2H2 414 436 3.9e-5 SMART
ZnF_C2H2 442 464 7e-7 SMART
ZnF_C2H2 470 492 2.5e-6 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
7530416G11Rik T C 15: 85,493,365 T133A unknown Het
Adgrl2 G T 3: 148,851,934 S519R probably damaging Het
Bhlhe22 A G 3: 18,055,451 N222D probably damaging Het
Cep72 C A 13: 74,048,977 A69S probably damaging Het
Csn1s2a T A 5: 87,780,155 probably null Het
Dapk1 T A 13: 60,752,216 F872I probably benign Het
Dhx57 T C 17: 80,260,416 D746G probably damaging Het
Dnah17 T A 11: 118,126,384 probably null Het
Fgg A G 3: 83,008,187 D37G possibly damaging Het
Fnip2 G T 3: 79,479,634 S958R probably benign Het
Gfpt1 A G 6: 87,087,348 D640G probably damaging Het
Golgb1 C A 16: 36,918,466 T2389K possibly damaging Het
Hmgcl C A 4: 135,952,368 probably null Het
Mmp11 T A 10: 75,925,510 T419S probably benign Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Nkiras1 T A 14: 18,280,011 V108E possibly damaging Het
Pcsk1 T C 13: 75,090,126 L22P probably benign Het
Rnf213 T C 11: 119,443,195 Y3077H probably damaging Het
Sec62 A G 3: 30,810,532 N182D unknown Het
Serpinb5 A G 1: 106,881,952 T363A probably damaging Het
Usf3 T A 16: 44,215,747 S197T probably benign Het
Vmn2r11 T A 5: 109,052,062 E508D probably benign Het
Wdr81 A G 11: 75,449,035 F1376L probably benign Het
Zfp260 T C 7: 30,104,701 S9P possibly damaging Het
Other mutations in AU041133
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03403:AU041133 APN 10 82138344 missense probably damaging 1.00
R0755:AU041133 UTSW 10 82150890 nonsense probably null
R1924:AU041133 UTSW 10 82151267 nonsense probably null
R2211:AU041133 UTSW 10 82150921 missense probably damaging 1.00
R3845:AU041133 UTSW 10 82151318 missense probably damaging 1.00
R3914:AU041133 UTSW 10 82151815 missense probably damaging 0.99
R4214:AU041133 UTSW 10 82151389 missense probably damaging 1.00
R4414:AU041133 UTSW 10 82151482 missense probably damaging 1.00
R5315:AU041133 UTSW 10 82151672 nonsense probably null
R5835:AU041133 UTSW 10 82151212 missense probably damaging 1.00
R6258:AU041133 UTSW 10 82151158 missense probably damaging 1.00
R6877:AU041133 UTSW 10 82151571 missense probably benign 0.24
R7127:AU041133 UTSW 10 82150866 missense probably benign 0.14
R7200:AU041133 UTSW 10 82151101 missense possibly damaging 0.94
R7228:AU041133 UTSW 10 82151271 missense possibly damaging 0.93
R7828:AU041133 UTSW 10 82151220 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGTTATTGCTGTGGAAACATCT -3'
(R):5'- GCAAAGGCTTTACCACATTGGT -3'

Sequencing Primer
(F):5'- TCTCTATAGCACATGTCAAGGGG -3'
(R):5'- CCACATTGGTTACATCCATAGGG -3'
Posted On2014-11-11