Incidental Mutation 'R0302:Itga1'
ID24866
Institutional Source Beutler Lab
Gene Symbol Itga1
Ensembl Gene ENSMUSG00000042284
Gene Nameintegrin alpha 1
SynonymsCD49A, Vla1, E130012M19Rik
MMRRC Submission 038514-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.492) question?
Stock #R0302 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location114953096-115101964 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 115012318 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000077132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061673]
Predicted Effect probably benign
Transcript: ENSMUST00000061673
SMART Domains Protein: ENSMUSP00000077132
Gene: ENSMUSG00000042284

DomainStartEndE-ValueType
Int_alpha 43 96 1.63e0 SMART
VWA 170 360 4.24e-44 SMART
Int_alpha 432 481 4.21e-3 SMART
Int_alpha 485 542 3.19e-12 SMART
Int_alpha 566 621 1.79e-15 SMART
Int_alpha 628 682 3.04e1 SMART
low complexity region 1108 1122 N/A INTRINSIC
PDB:2L8S|A 1135 1179 5e-10 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224119
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224268
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224865
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.1%
  • 20x: 89.5%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha 1 subunit of integrin receptors. This protein heterodimerizes with the beta 1 subunit to form a cell-surface receptor for collagen and laminin. The heterodimeric receptor is involved in cell-cell adhesion and may play a role in inflammation and fibrosis. The alpha 1 subunit contains an inserted (I) von Willebrand factor type I domain which is thought to be involved in collagen binding. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are essentially normal although their kidneys are smaller and more succeptible to injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl2 T C 4: 126,317,392 E244G probably benign Het
Aldh1l2 G A 10: 83,520,365 P54S probably damaging Het
Ankdd1a G A 9: 65,509,642 probably benign Het
Ankra2 T A 13: 98,271,692 S216R probably damaging Het
Asah2 A T 19: 32,052,956 N105K probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Cacna1s A G 1: 136,100,604 Y893C probably benign Het
Capza2 G A 6: 17,648,524 R15H probably benign Het
Cbfa2t2 T C 2: 154,534,876 probably benign Het
Ccdc96 A T 5: 36,486,101 T484S possibly damaging Het
Cckar GCTTAGCCTCTTCT GCT 5: 53,700,299 probably null Het
Ccl4 T A 11: 83,663,454 probably benign Het
Cpt1b A G 15: 89,417,870 Y702H probably benign Het
Cr1l G A 1: 195,117,793 T153I probably damaging Het
Cyth2 C A 7: 45,810,585 E57* probably null Het
Daxx T A 17: 33,913,620 S575T probably damaging Het
Depdc5 T C 5: 32,904,546 probably benign Het
Dnah12 A G 14: 26,799,999 D1923G probably damaging Het
Dnah7b A G 1: 46,123,777 T428A probably benign Het
Dnm2 G T 9: 21,500,343 A619S probably benign Het
Enpp2 T C 15: 54,860,061 T639A probably benign Het
Epsti1 A T 14: 77,939,926 H182L probably damaging Het
Exoc3l C T 8: 105,293,543 R250Q probably benign Het
Ggn G T 7: 29,171,240 probably null Het
Il1rap A G 16: 26,692,794 N196S probably benign Het
Ints6 T C 14: 62,709,512 T335A probably damaging Het
Kifc3 G T 8: 95,103,470 Q557K possibly damaging Het
Krt23 A G 11: 99,478,201 I422T probably benign Het
Lcn2 A G 2: 32,384,889 probably benign Het
Lonp2 A G 8: 86,637,991 T326A possibly damaging Het
Lrpprc T C 17: 84,740,078 I909V possibly damaging Het
Lrrc14 G T 15: 76,714,352 R396L probably benign Het
Lypd6 T G 2: 50,165,667 probably benign Het
Man2b1 A G 8: 85,093,016 N610S probably damaging Het
Map2 A T 1: 66,414,828 N959I probably benign Het
Mctp2 C T 7: 72,090,264 V793I possibly damaging Het
Med25 A C 7: 44,880,558 probably benign Het
Mfsd6 T C 1: 52,709,457 Y83C probably damaging Het
Mtbp A T 15: 55,625,424 M499L probably damaging Het
Mtmr10 A T 7: 64,297,497 K53N probably damaging Het
Nfat5 T C 8: 107,358,701 I542T probably damaging Het
Nr1h3 A G 2: 91,192,013 M90T probably damaging Het
Nsmce4a A G 7: 130,545,893 probably benign Het
Olfr1168 T A 2: 88,185,510 I211N possibly damaging Het
Oprl1 G A 2: 181,719,228 C318Y probably benign Het
Pbx3 A T 2: 34,224,560 S46T probably benign Het
Pign A T 1: 105,589,093 F575I possibly damaging Het
Ptpn13 G T 5: 103,565,225 S1738I probably benign Het
Rnf126 G T 10: 79,759,223 P269Q probably damaging Het
Ryr3 G A 2: 112,647,123 probably benign Het
Slc2a7 C T 4: 150,149,521 A31V probably damaging Het
Slc6a12 A G 6: 121,363,259 D487G probably damaging Het
Son G T 16: 91,656,144 G593V probably damaging Het
Spata31d1a T C 13: 59,703,150 N388S probably benign Het
Spg11 A T 2: 122,092,187 M927K possibly damaging Het
Taf13 A G 3: 108,571,722 M1V probably null Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Trio A G 15: 27,902,517 F286S probably damaging Het
Trpm2 A C 10: 77,943,990 probably benign Het
Ttc7b T C 12: 100,387,179 M390V possibly damaging Het
Vmn1r184 A T 7: 26,267,543 Q238L probably damaging Het
Zfp236 T C 18: 82,658,088 E368G probably damaging Het
Zfr2 G T 10: 81,251,336 probably benign Het
Other mutations in Itga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Itga1 APN 13 114992363 missense possibly damaging 0.80
IGL00498:Itga1 APN 13 115031193 missense probably benign 0.00
IGL00549:Itga1 APN 13 115049296 missense possibly damaging 0.92
IGL00587:Itga1 APN 13 115012249 missense probably damaging 1.00
IGL01021:Itga1 APN 13 114997000 missense probably benign 0.29
IGL01289:Itga1 APN 13 114986226 missense possibly damaging 0.79
IGL01636:Itga1 APN 13 115006948 missense possibly damaging 0.73
IGL01791:Itga1 APN 13 114987661 missense probably benign 0.00
IGL01796:Itga1 APN 13 114985121 missense probably damaging 1.00
IGL02027:Itga1 APN 13 114990055 splice site probably null
IGL02330:Itga1 APN 13 115012204 missense probably damaging 1.00
IGL02480:Itga1 APN 13 114987648 missense probably damaging 1.00
IGL02943:Itga1 APN 13 115049296 missense possibly damaging 0.92
R0103:Itga1 UTSW 13 115016254 missense probably benign 0.40
R0103:Itga1 UTSW 13 115016254 missense probably benign 0.40
R0244:Itga1 UTSW 13 115006897 splice site probably benign
R0265:Itga1 UTSW 13 114992459 missense probably benign
R0320:Itga1 UTSW 13 114977594 splice site probably benign
R0389:Itga1 UTSW 13 114992460 missense probably benign 0.04
R0443:Itga1 UTSW 13 114992460 missense probably benign 0.04
R0574:Itga1 UTSW 13 114966561 missense probably damaging 1.00
R0646:Itga1 UTSW 13 114968299 missense probably benign
R0830:Itga1 UTSW 13 115007032 missense probably benign 0.08
R2162:Itga1 UTSW 13 115030910 missense probably benign 0.23
R2216:Itga1 UTSW 13 114997029 missense probably benign 0.00
R2403:Itga1 UTSW 13 114977614 missense probably benign 0.00
R3734:Itga1 UTSW 13 114977639 missense probably benign
R4171:Itga1 UTSW 13 115030886 nonsense probably null
R4402:Itga1 UTSW 13 115001566 missense probably benign 0.00
R4675:Itga1 UTSW 13 115001691 splice site probably null
R4684:Itga1 UTSW 13 115049370 missense probably damaging 1.00
R4795:Itga1 UTSW 13 115035385 missense probably damaging 1.00
R4796:Itga1 UTSW 13 115035385 missense probably damaging 1.00
R4845:Itga1 UTSW 13 114974172 nonsense probably null
R5147:Itga1 UTSW 13 114985142 missense possibly damaging 0.91
R5155:Itga1 UTSW 13 115035303 missense probably benign
R5234:Itga1 UTSW 13 115049303 nonsense probably null
R5344:Itga1 UTSW 13 115002309 missense possibly damaging 0.78
R5554:Itga1 UTSW 13 114992474 nonsense probably null
R5662:Itga1 UTSW 13 114986171 missense probably benign 0.03
R5945:Itga1 UTSW 13 114966590 missense probably benign 0.02
R6150:Itga1 UTSW 13 114968233 missense probably benign 0.01
R6241:Itga1 UTSW 13 114960137 splice site probably null
R6276:Itga1 UTSW 13 114980852 missense probably benign
R6369:Itga1 UTSW 13 114965660 missense probably damaging 1.00
R6511:Itga1 UTSW 13 114992501 missense probably damaging 0.98
R6663:Itga1 UTSW 13 114974105 missense probably benign 0.02
R6783:Itga1 UTSW 13 114996977 missense probably benign 0.22
R6931:Itga1 UTSW 13 115001563 missense probably benign 0.39
R7069:Itga1 UTSW 13 114968240 missense probably damaging 1.00
R7458:Itga1 UTSW 13 114986266 missense probably benign 0.00
R7588:Itga1 UTSW 13 114968249 missense possibly damaging 0.88
R7591:Itga1 UTSW 13 114982779 missense probably damaging 1.00
R7597:Itga1 UTSW 13 114974140 missense probably benign 0.28
R7615:Itga1 UTSW 13 114996922 missense probably null 0.99
R7756:Itga1 UTSW 13 114992460 missense probably benign 0.04
R7795:Itga1 UTSW 13 115012236 missense probably damaging 1.00
R7819:Itga1 UTSW 13 115049301 missense probably damaging 0.99
Z1177:Itga1 UTSW 13 114985071 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACCACGATTGGCTTGTTAGTGGATG -3'
(R):5'- GAGTTGCCATGCTGTGCAAACC -3'

Sequencing Primer
(F):5'- TAGGATCTCAGGAGTTTCCAAACC -3'
(R):5'- TGCAAACCCTGTGGAACTATG -3'
Posted On2013-04-16