Incidental Mutation 'R2400:Cep72'
ID248663
Institutional Source Beutler Lab
Gene Symbol Cep72
Ensembl Gene ENSMUSG00000021572
Gene Namecentrosomal protein 72
Synonyms
MMRRC Submission 040366-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R2400 (G1)
Quality Score193
Status Not validated
Chromosome13
Chromosomal Location74036500-74062299 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 74048977 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 69 (A69S)
Ref Sequence ENSEMBL: ENSMUSP00000152484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036456] [ENSMUST00000221122] [ENSMUST00000222609]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036456
AA Change: A420S

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000037788
Gene: ENSMUSG00000021572
AA Change: A420S

DomainStartEndE-ValueType
LRR 52 73 2.92e1 SMART
LRR 74 96 5.34e-1 SMART
LRRcap 116 134 1.89e-4 SMART
low complexity region 307 319 N/A INTRINSIC
low complexity region 378 389 N/A INTRINSIC
low complexity region 417 428 N/A INTRINSIC
coiled coil region 485 531 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000221122
AA Change: A69S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000222609
AA Change: A333S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000223028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223417
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a member of the leucine-rich-repeat (LRR) superfamily of proteins. The protein is localized to the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
7530416G11Rik T C 15: 85,493,365 T133A unknown Het
Adgrl2 G T 3: 148,851,934 S519R probably damaging Het
AU041133 A T 10: 82,150,908 K132* probably null Het
Bhlhe22 A G 3: 18,055,451 N222D probably damaging Het
Csn1s2a T A 5: 87,780,155 probably null Het
Dapk1 T A 13: 60,752,216 F872I probably benign Het
Dhx57 T C 17: 80,260,416 D746G probably damaging Het
Dnah17 T A 11: 118,126,384 probably null Het
Fgg A G 3: 83,008,187 D37G possibly damaging Het
Fnip2 G T 3: 79,479,634 S958R probably benign Het
Gfpt1 A G 6: 87,087,348 D640G probably damaging Het
Golgb1 C A 16: 36,918,466 T2389K possibly damaging Het
Hmgcl C A 4: 135,952,368 probably null Het
Mmp11 T A 10: 75,925,510 T419S probably benign Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Nkiras1 T A 14: 18,280,011 V108E possibly damaging Het
Pcsk1 T C 13: 75,090,126 L22P probably benign Het
Rnf213 T C 11: 119,443,195 Y3077H probably damaging Het
Sec62 A G 3: 30,810,532 N182D unknown Het
Serpinb5 A G 1: 106,881,952 T363A probably damaging Het
Usf3 T A 16: 44,215,747 S197T probably benign Het
Vmn2r11 T A 5: 109,052,062 E508D probably benign Het
Wdr81 A G 11: 75,449,035 F1376L probably benign Het
Zfp260 T C 7: 30,104,701 S9P possibly damaging Het
Other mutations in Cep72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Cep72 APN 13 74062268 unclassified probably benign
IGL01373:Cep72 APN 13 74059459 missense probably damaging 1.00
IGL02415:Cep72 APN 13 74050154 missense probably benign 0.31
IGL03372:Cep72 APN 13 74043518 missense possibly damaging 0.47
R0608:Cep72 UTSW 13 74038304 missense probably damaging 1.00
R0884:Cep72 UTSW 13 74054881 critical splice donor site probably null
R4906:Cep72 UTSW 13 74059465 missense probably damaging 1.00
R5534:Cep72 UTSW 13 74062216 missense probably benign 0.05
R5567:Cep72 UTSW 13 74040141 missense probably benign 0.00
R5570:Cep72 UTSW 13 74040141 missense probably benign 0.00
R5816:Cep72 UTSW 13 74049031 missense probably benign 0.43
R6310:Cep72 UTSW 13 74053025 missense possibly damaging 0.94
R6513:Cep72 UTSW 13 74058463 missense probably damaging 1.00
R6848:Cep72 UTSW 13 74038276 missense possibly damaging 0.85
R6936:Cep72 UTSW 13 74040087 missense probably damaging 1.00
R7000:Cep72 UTSW 13 74058325 missense probably damaging 0.96
R7006:Cep72 UTSW 13 74050308 nonsense probably null
R7074:Cep72 UTSW 13 74051580 missense probably benign 0.16
R7640:Cep72 UTSW 13 74058488 nonsense probably null
R7889:Cep72 UTSW 13 74050122 missense possibly damaging 0.84
R7972:Cep72 UTSW 13 74050122 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- GGGACAATAATTCACTTCTCTGGAAC -3'
(R):5'- AGCTTCACAGATGGGTGTCTC -3'

Sequencing Primer
(F):5'- ACCCCAGGTTGGATGAACACTG -3'
(R):5'- CACAGATGGGTGTCTCTTGTTCTC -3'
Posted On2014-11-11