Incidental Mutation 'R2400:Dhx57'
ID248670
Institutional Source Beutler Lab
Gene Symbol Dhx57
Ensembl Gene ENSMUSG00000035051
Gene NameDEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57
Synonyms
MMRRC Submission 040366-MU
Accession Numbers

NCBI RefSeq: NM_001163759.1, NM_198942.2; MGI:2147067

Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R2400 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location80238304-80290476 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80260416 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 746 (D746G)
Ref Sequence ENSEMBL: ENSMUSP00000083742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038166] [ENSMUST00000086555]
Predicted Effect probably damaging
Transcript: ENSMUST00000038166
AA Change: D693G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000041069
Gene: ENSMUSG00000035051
AA Change: D693G

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 116 125 N/A INTRINSIC
UBA 129 166 1.04e-3 SMART
ZnF_C3H1 246 272 4.07e-6 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 381 390 N/A INTRINSIC
low complexity region 423 432 N/A INTRINSIC
DEXDc 490 678 1.27e-28 SMART
Blast:DEXDc 688 752 2e-28 BLAST
HELICc 810 918 3.22e-16 SMART
HA2 984 1074 1.64e-24 SMART
Pfam:OB_NTP_bind 1113 1262 1.5e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000086555
AA Change: D746G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000083742
Gene: ENSMUSG00000035051
AA Change: D746G

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 169 178 N/A INTRINSIC
UBA 182 219 1.04e-3 SMART
ZnF_C3H1 299 325 4.07e-6 SMART
low complexity region 410 421 N/A INTRINSIC
low complexity region 434 443 N/A INTRINSIC
low complexity region 476 485 N/A INTRINSIC
DEXDc 543 731 1.27e-28 SMART
Blast:DEXDc 741 805 1e-28 BLAST
HELICc 863 971 3.22e-16 SMART
HA2 1037 1127 1.64e-24 SMART
Pfam:OB_NTP_bind 1166 1315 8.5e-25 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI

All alleles(25) : Gene trapped(25)

Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
7530416G11Rik T C 15: 85,493,365 T133A unknown Het
Adgrl2 G T 3: 148,851,934 S519R probably damaging Het
AU041133 A T 10: 82,150,908 K132* probably null Het
Bhlhe22 A G 3: 18,055,451 N222D probably damaging Het
Cep72 C A 13: 74,048,977 A69S probably damaging Het
Csn1s2a T A 5: 87,780,155 probably null Het
Dapk1 T A 13: 60,752,216 F872I probably benign Het
Dnah17 T A 11: 118,126,384 probably null Het
Fgg A G 3: 83,008,187 D37G possibly damaging Het
Fnip2 G T 3: 79,479,634 S958R probably benign Het
Gfpt1 A G 6: 87,087,348 D640G probably damaging Het
Golgb1 C A 16: 36,918,466 T2389K possibly damaging Het
Hmgcl C A 4: 135,952,368 probably null Het
Mmp11 T A 10: 75,925,510 T419S probably benign Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Nkiras1 T A 14: 18,280,011 V108E possibly damaging Het
Pcsk1 T C 13: 75,090,126 L22P probably benign Het
Rnf213 T C 11: 119,443,195 Y3077H probably damaging Het
Sec62 A G 3: 30,810,532 N182D unknown Het
Serpinb5 A G 1: 106,881,952 T363A probably damaging Het
Usf3 T A 16: 44,215,747 S197T probably benign Het
Vmn2r11 T A 5: 109,052,062 E508D probably benign Het
Wdr81 A G 11: 75,449,035 F1376L probably benign Het
Zfp260 T C 7: 30,104,701 S9P possibly damaging Het
Other mutations in Dhx57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00642:Dhx57 APN 17 80274976 missense probably benign 0.00
IGL00811:Dhx57 APN 17 80253243 missense probably damaging 1.00
IGL01389:Dhx57 APN 17 80281223 missense probably benign 0.28
IGL01468:Dhx57 APN 17 80255610 nonsense probably null
IGL01908:Dhx57 APN 17 80251443 missense probably damaging 1.00
IGL01965:Dhx57 APN 17 80268850 missense probably damaging 1.00
IGL02147:Dhx57 APN 17 80260323 missense possibly damaging 0.95
IGL02275:Dhx57 APN 17 80274839 missense probably benign 0.13
IGL02349:Dhx57 APN 17 80255571 missense probably damaging 1.00
IGL02405:Dhx57 APN 17 80255550 critical splice donor site probably null
IGL02588:Dhx57 APN 17 80268871 missense probably damaging 1.00
IGL02673:Dhx57 APN 17 80267545 missense probably damaging 1.00
IGL02836:Dhx57 APN 17 80267549 missense probably damaging 1.00
IGL02889:Dhx57 APN 17 80247152 missense possibly damaging 0.90
IGL03085:Dhx57 APN 17 80258097 missense possibly damaging 0.48
P0014:Dhx57 UTSW 17 80275191 missense probably benign 0.00
PIT4377001:Dhx57 UTSW 17 80263975 missense probably damaging 0.96
R0100:Dhx57 UTSW 17 80275156 missense possibly damaging 0.82
R0100:Dhx57 UTSW 17 80275156 missense possibly damaging 0.82
R0129:Dhx57 UTSW 17 80238914 missense probably damaging 1.00
R0200:Dhx57 UTSW 17 80251473 missense probably damaging 1.00
R0309:Dhx57 UTSW 17 80274881 missense probably damaging 1.00
R0375:Dhx57 UTSW 17 80258121 missense probably damaging 1.00
R0396:Dhx57 UTSW 17 80274797 missense probably benign 0.34
R0520:Dhx57 UTSW 17 80258175 missense possibly damaging 0.95
R0554:Dhx57 UTSW 17 80260236 nonsense probably null
R0661:Dhx57 UTSW 17 80268864 missense probably damaging 1.00
R0883:Dhx57 UTSW 17 80270371 missense probably damaging 1.00
R0900:Dhx57 UTSW 17 80275582 missense probably benign
R0963:Dhx57 UTSW 17 80275527 missense probably benign 0.01
R1469:Dhx57 UTSW 17 80254418 missense probably damaging 1.00
R1469:Dhx57 UTSW 17 80254418 missense probably damaging 1.00
R1660:Dhx57 UTSW 17 80245728 missense possibly damaging 0.83
R1707:Dhx57 UTSW 17 80275226 missense probably damaging 0.96
R1822:Dhx57 UTSW 17 80253085 critical splice donor site probably null
R1853:Dhx57 UTSW 17 80274879 nonsense probably null
R1942:Dhx57 UTSW 17 80265144 missense probably damaging 1.00
R2043:Dhx57 UTSW 17 80253080 splice site probably benign
R2106:Dhx57 UTSW 17 80275363 missense probably damaging 1.00
R2127:Dhx57 UTSW 17 80273048 missense probably damaging 1.00
R2183:Dhx57 UTSW 17 80275331 missense probably benign 0.07
R2249:Dhx57 UTSW 17 80281234 missense probably damaging 0.98
R2404:Dhx57 UTSW 17 80254304 missense probably damaging 0.98
R2513:Dhx57 UTSW 17 80241949 splice site probably null
R2869:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2869:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2870:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2870:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2871:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2871:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2874:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R3819:Dhx57 UTSW 17 80265074 critical splice donor site probably null
R3964:Dhx57 UTSW 17 80265112 nonsense probably null
R4535:Dhx57 UTSW 17 80275082 missense probably damaging 1.00
R4666:Dhx57 UTSW 17 80274961 missense probably damaging 1.00
R4788:Dhx57 UTSW 17 80275331 missense probably benign 0.01
R4822:Dhx57 UTSW 17 80242167 splice site probably null
R4863:Dhx57 UTSW 17 80253111 missense probably damaging 1.00
R4988:Dhx57 UTSW 17 80251398 missense probably damaging 1.00
R5391:Dhx57 UTSW 17 80275081 missense probably damaging 1.00
R5559:Dhx57 UTSW 17 80254379 missense possibly damaging 0.53
R5644:Dhx57 UTSW 17 80238873 missense possibly damaging 0.73
R5997:Dhx57 UTSW 17 80245806 missense probably damaging 0.96
R6090:Dhx57 UTSW 17 80263946 critical splice donor site probably null
R6177:Dhx57 UTSW 17 80272966 missense possibly damaging 0.91
R6283:Dhx57 UTSW 17 80274805 missense probably benign 0.00
R6802:Dhx57 UTSW 17 80275321 missense probably benign 0.43
R6924:Dhx57 UTSW 17 80238815 missense possibly damaging 0.71
R7151:Dhx57 UTSW 17 80273047 missense probably damaging 1.00
R7386:Dhx57 UTSW 17 80267577 missense possibly damaging 0.89
R7393:Dhx57 UTSW 17 80255571 missense probably damaging 1.00
R7451:Dhx57 UTSW 17 80247113 missense probably damaging 1.00
R7602:Dhx57 UTSW 17 80274861 missense probably benign 0.06
R7733:Dhx57 UTSW 17 80265074 critical splice donor site probably null
R7748:Dhx57 UTSW 17 80265117 missense probably damaging 1.00
R7749:Dhx57 UTSW 17 80238858 missense probably benign 0.04
R7772:Dhx57 UTSW 17 80273078 missense possibly damaging 0.71
R8213:Dhx57 UTSW 17 80275156 missense possibly damaging 0.82
Z1088:Dhx57 UTSW 17 80251348 missense probably damaging 1.00
Z1176:Dhx57 UTSW 17 80245805 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGCACACTTGACACCATTCC -3'
(R):5'- GTGTGTTCCCAACCAAACG -3'

Sequencing Primer
(F):5'- CCTTTATAACGGATCAAGAGCTGC -3'
(R):5'- AACCAAACGGGGCACAG -3'
Posted On2014-11-11