Mutagenetix > Incidental Mutation

Incidental Mutation 'R2400:Dhx57'

248670

Institutional Source

Beutler Lab

Gene Symbol

Dhx57

Ensembl Gene

ENSMUSG00000035051

Gene Name

DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57

Synonyms

MMRRC Submission

040366-MU

Accession Numbers

NCBI RefSeq: NM_001163759.1, NM_198942.2; MGI:2147067

Essential gene?

Probably non essential (E-score: 0.143) question?

Stock #

R2400 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

80238304-80290476 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 80260416 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 746 (D746G)

Ref Sequence

ENSEMBL: ENSMUSP00000083742 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038166] [ENSMUST00000086555]

AlphaFold

Q6P5D3

Predicted Effect

probably damaging
Transcript: ENSMUST00000038166
AA Change: D693G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000041069
Gene: ENSMUSG00000035051
AA Change: D693G

Domain	Start	End	E-Value	Type
low complexity region	6	50	N/A	INTRINSIC
low complexity region	116	125	N/A	INTRINSIC
UBA	129	166	1.04e-3	SMART
ZnF_C3H1	246	272	4.07e-6	SMART
low complexity region	357	368	N/A	INTRINSIC
low complexity region	381	390	N/A	INTRINSIC
low complexity region	423	432	N/A	INTRINSIC
DEXDc	490	678	1.27e-28	SMART
Blast:DEXDc	688	752	2e-28	BLAST
HELICc	810	918	3.22e-16	SMART
HA2	984	1074	1.64e-24	SMART
Pfam:OB_NTP_bind	1113	1262	1.5e-20	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000086555
AA Change: D746G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000083742
Gene: ENSMUSG00000035051
AA Change: D746G

Domain	Start	End	E-Value	Type
low complexity region	6	50	N/A	INTRINSIC
low complexity region	169	178	N/A	INTRINSIC
UBA	182	219	1.04e-3	SMART
ZnF_C3H1	299	325	4.07e-6	SMART
low complexity region	410	421	N/A	INTRINSIC
low complexity region	434	443	N/A	INTRINSIC
low complexity region	476	485	N/A	INTRINSIC
DEXDc	543	731	1.27e-28	SMART
Blast:DEXDc	741	805	1e-28	BLAST
HELICc	863	971	3.22e-16	SMART
HA2	1037	1127	1.64e-24	SMART
Pfam:OB_NTP_bind	1166	1315	8.5e-25	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.4%

Validation Efficiency

Allele List at MGI

All alleles(25) : Gene trapped(25)

Other mutations in this stock

Total: 24 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
7530416G11Rik	T	C	15: 85,493,365	T133A	unknown	Het
Adgrl2	G	T	3: 148,851,934	S519R	probably damaging	Het
AU041133	A	T	10: 82,150,908	K132*	probably null	Het
Bhlhe22	A	G	3: 18,055,451	N222D	probably damaging	Het
Cep72	C	A	13: 74,048,977	A69S	probably damaging	Het
Csn1s2a	T	A	5: 87,780,155		probably null	Het
Dapk1	T	A	13: 60,752,216	F872I	probably benign	Het
Dnah17	T	A	11: 118,126,384		probably null	Het
Fgg	A	G	3: 83,008,187	D37G	possibly damaging	Het
Fnip2	G	T	3: 79,479,634	S958R	probably benign	Het
Gfpt1	A	G	6: 87,087,348	D640G	probably damaging	Het
Golgb1	C	A	16: 36,918,466	T2389K	possibly damaging	Het
Hmgcl	C	A	4: 135,952,368		probably null	Het
Mmp11	T	A	10: 75,925,510	T419S	probably benign	Het
Myg1	G	C	15: 102,337,736	G349R	probably damaging	Het
Nkiras1	T	A	14: 18,280,011	V108E	possibly damaging	Het
Pcsk1	T	C	13: 75,090,126	L22P	probably benign	Het
Rnf213	T	C	11: 119,443,195	Y3077H	probably damaging	Het
Sec62	A	G	3: 30,810,532	N182D	unknown	Het
Serpinb5	A	G	1: 106,881,952	T363A	probably damaging	Het
Usf3	T	A	16: 44,215,747	S197T	probably benign	Het
Vmn2r11	T	A	5: 109,052,062	E508D	probably benign	Het
Wdr81	A	G	11: 75,449,035	F1376L	probably benign	Het
Zfp260	T	C	7: 30,104,701	S9P	possibly damaging	Het

Other mutations in Dhx57

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00642:Dhx57	APN	17	80274976	missense	probably benign	0.00
IGL00811:Dhx57	APN	17	80253243	missense	probably damaging	1.00
IGL01389:Dhx57	APN	17	80281223	missense	probably benign	0.28
IGL01468:Dhx57	APN	17	80255610	nonsense	probably null
IGL01908:Dhx57	APN	17	80251443	missense	probably damaging	1.00
IGL01965:Dhx57	APN	17	80268850	missense	probably damaging	1.00
IGL02147:Dhx57	APN	17	80260323	missense	possibly damaging	0.95
IGL02275:Dhx57	APN	17	80274839	missense	probably benign	0.13
IGL02349:Dhx57	APN	17	80255571	missense	probably damaging	1.00
IGL02405:Dhx57	APN	17	80255550	critical splice donor site	probably null
IGL02588:Dhx57	APN	17	80268871	missense	probably damaging	1.00
IGL02673:Dhx57	APN	17	80267545	missense	probably damaging	1.00
IGL02836:Dhx57	APN	17	80267549	missense	probably damaging	1.00
IGL02889:Dhx57	APN	17	80247152	missense	possibly damaging	0.90
IGL03085:Dhx57	APN	17	80258097	missense	possibly damaging	0.48
P0014:Dhx57	UTSW	17	80275191	missense	probably benign	0.00
PIT4377001:Dhx57	UTSW	17	80263975	missense	probably damaging	0.96
R0100:Dhx57	UTSW	17	80275156	missense	possibly damaging	0.82
R0100:Dhx57	UTSW	17	80275156	missense	possibly damaging	0.82
R0129:Dhx57	UTSW	17	80238914	missense	probably damaging	1.00
R0200:Dhx57	UTSW	17	80251473	missense	probably damaging	1.00
R0309:Dhx57	UTSW	17	80274881	missense	probably damaging	1.00
R0375:Dhx57	UTSW	17	80258121	missense	probably damaging	1.00
R0396:Dhx57	UTSW	17	80274797	missense	probably benign	0.34
R0520:Dhx57	UTSW	17	80258175	missense	possibly damaging	0.95
R0554:Dhx57	UTSW	17	80260236	nonsense	probably null
R0661:Dhx57	UTSW	17	80268864	missense	probably damaging	1.00
R0883:Dhx57	UTSW	17	80270371	missense	probably damaging	1.00
R0900:Dhx57	UTSW	17	80275582	missense	probably benign
R0963:Dhx57	UTSW	17	80275527	missense	probably benign	0.01
R1469:Dhx57	UTSW	17	80254418	missense	probably damaging	1.00
R1469:Dhx57	UTSW	17	80254418	missense	probably damaging	1.00
R1660:Dhx57	UTSW	17	80245728	missense	possibly damaging	0.83
R1707:Dhx57	UTSW	17	80275226	missense	probably damaging	0.96
R1822:Dhx57	UTSW	17	80253085	critical splice donor site	probably null
R1853:Dhx57	UTSW	17	80274879	nonsense	probably null
R1942:Dhx57	UTSW	17	80265144	missense	probably damaging	1.00
R2043:Dhx57	UTSW	17	80253080	splice site	probably benign
R2106:Dhx57	UTSW	17	80275363	missense	probably damaging	1.00
R2127:Dhx57	UTSW	17	80273048	missense	probably damaging	1.00
R2183:Dhx57	UTSW	17	80275331	missense	probably benign	0.07
R2249:Dhx57	UTSW	17	80281234	missense	probably damaging	0.98
R2404:Dhx57	UTSW	17	80254304	missense	probably damaging	0.98
R2513:Dhx57	UTSW	17	80241949	splice site	probably null
R2869:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2869:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2870:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2870:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2871:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2871:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2874:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R3819:Dhx57	UTSW	17	80265074	critical splice donor site	probably null
R3964:Dhx57	UTSW	17	80265112	nonsense	probably null
R4535:Dhx57	UTSW	17	80275082	missense	probably damaging	1.00
R4666:Dhx57	UTSW	17	80274961	missense	probably damaging	1.00
R4788:Dhx57	UTSW	17	80275331	missense	probably benign	0.01
R4822:Dhx57	UTSW	17	80242167	splice site	probably null
R4863:Dhx57	UTSW	17	80253111	missense	probably damaging	1.00
R4988:Dhx57	UTSW	17	80251398	missense	probably damaging	1.00
R5391:Dhx57	UTSW	17	80275081	missense	probably damaging	1.00
R5559:Dhx57	UTSW	17	80254379	missense	possibly damaging	0.53
R5644:Dhx57	UTSW	17	80238873	missense	possibly damaging	0.73
R5997:Dhx57	UTSW	17	80245806	missense	probably damaging	0.96
R6090:Dhx57	UTSW	17	80263946	critical splice donor site	probably null
R6177:Dhx57	UTSW	17	80272966	missense	possibly damaging	0.91
R6283:Dhx57	UTSW	17	80274805	missense	probably benign	0.00
R6802:Dhx57	UTSW	17	80275321	missense	probably benign	0.43
R6924:Dhx57	UTSW	17	80238815	missense	possibly damaging	0.71
R7151:Dhx57	UTSW	17	80273047	missense	probably damaging	1.00
R7386:Dhx57	UTSW	17	80267577	missense	possibly damaging	0.89
R7393:Dhx57	UTSW	17	80255571	missense	probably damaging	1.00
R7451:Dhx57	UTSW	17	80247113	missense	probably damaging	1.00
R7602:Dhx57	UTSW	17	80274861	missense	probably benign	0.06
R7733:Dhx57	UTSW	17	80265074	critical splice donor site	probably null
R7748:Dhx57	UTSW	17	80265117	missense	probably damaging	1.00
R7749:Dhx57	UTSW	17	80238858	missense	probably benign	0.04
R7772:Dhx57	UTSW	17	80273078	missense	possibly damaging	0.71
R8213:Dhx57	UTSW	17	80275156	missense	possibly damaging	0.82
R8370:Dhx57	UTSW	17	80245763	missense	probably damaging	1.00
R8371:Dhx57	UTSW	17	80275490	missense	probably benign	0.18
R8403:Dhx57	UTSW	17	80278289	missense	probably damaging	1.00
R8467:Dhx57	UTSW	17	80254424	missense	probably damaging	1.00
R8690:Dhx57	UTSW	17	80270365	critical splice donor site	probably benign
R9210:Dhx57	UTSW	17	80268909	missense	probably damaging	1.00
R9212:Dhx57	UTSW	17	80268909	missense	probably damaging	1.00
R9447:Dhx57	UTSW	17	80242094	missense	probably damaging	1.00
R9562:Dhx57	UTSW	17	80254388	missense	probably damaging	1.00
R9669:Dhx57	UTSW	17	80245701	missense	probably benign	0.09
R9717:Dhx57	UTSW	17	80275018	missense	probably damaging	1.00
Z1088:Dhx57	UTSW	17	80251348	missense	probably damaging	1.00
Z1176:Dhx57	UTSW	17	80245805	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- GGCACACTTGACACCATTCC -3'
(R):5'- GTGTGTTCCCAACCAAACG -3'

Sequencing Primer
(F):5'- CCTTTATAACGGATCAAGAGCTGC -3'
(R):5'- AACCAAACGGGGCACAG -3'

Posted On

2014-11-11