Incidental Mutation 'R2401:Kif16b'
ID 248675
Institutional Source Beutler Lab
Gene Symbol Kif16b
Ensembl Gene ENSMUSG00000038844
Gene Name kinesin family member 16B
Synonyms 8430434E15Rik, N-3 kinesin
MMRRC Submission 040367-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2401 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 142617474-142901531 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 142756122 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 527 (V527I)
Ref Sequence ENSEMBL: ENSMUSP00000148731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043589] [ENSMUST00000211861] [ENSMUST00000230763]
AlphaFold B1AVY7
Predicted Effect probably benign
Transcript: ENSMUST00000043589
AA Change: V527I

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000042551
Gene: ENSMUSG00000038844
AA Change: V527I

DomainStartEndE-ValueType
KISc 1 366 4.87e-173 SMART
FHA 477 529 1.43e-1 SMART
coiled coil region 597 809 N/A INTRINSIC
coiled coil region 835 858 N/A INTRINSIC
coiled coil region 941 1022 N/A INTRINSIC
PX 1179 1281 1.58e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211861
AA Change: V527I

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000230763
AA Change: V527I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.0966 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a kinesin-like protein that may be involved in intracellular trafficking. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Chimera embryos containing a knock-out allele and derived from tetraploid rescue exhibit lethal growth arrest at the blastocyst stage with abnormal development of the primitive endoderm, epiblast epithelium, and basement membrane. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 120,283,089 L1158P probably damaging Het
Acnat1 A T 4: 49,451,077 N11K possibly damaging Het
Ammecr1l T A 18: 31,776,003 I217N possibly damaging Het
Ankrd11 G A 8: 122,908,734 R54* probably null Het
Ccdc178 C T 18: 22,131,414 probably null Het
Ccdc36 G T 9: 108,413,006 T133N possibly damaging Het
Clcn7 T C 17: 25,153,140 S425P probably benign Het
Cnmd A G 14: 79,656,605 V114A probably damaging Het
Col13a1 T C 10: 61,851,162 T651A unknown Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyp3a25 T C 5: 145,986,968 probably null Het
Dmrta1 A T 4: 89,691,616 D271V probably benign Het
Efcab3 T A 11: 105,072,318 probably null Het
Exo5 T C 4: 120,921,997 I224V probably damaging Het
Fam162b C A 10: 51,587,218 A118S probably damaging Het
Glb1 A G 9: 114,454,257 T406A possibly damaging Het
Grk3 T C 5: 112,914,983 N666S probably benign Het
Hars2 T C 18: 36,789,523 F370L possibly damaging Het
Ighv8-11 T G 12: 115,567,603 probably benign Het
Inpp4b A T 8: 81,997,339 D500V probably benign Het
Itgb4 A G 11: 116,006,563 D1534G possibly damaging Het
Kcnk2 G C 1: 189,340,017 T38S possibly damaging Het
Kmt2b A G 7: 30,576,708 Y1789H probably damaging Het
Lpl A C 8: 68,901,243 D412A possibly damaging Het
Lrrc27 T G 7: 139,223,613 L151R probably damaging Het
Muc3 T C 5: 137,154,041 probably benign Het
Nup205 T A 6: 35,208,134 Y829* probably null Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfm4 A G 14: 80,021,752 Y447C probably damaging Het
Olfr1308 T C 2: 111,960,149 Y308C probably benign Het
Pcdhb6 T C 18: 37,335,169 V381A probably benign Het
Prmt2 C T 10: 76,225,415 W79* probably null Het
Skiv2l T C 17: 34,840,385 M1029V probably benign Het
Stil A G 4: 115,016,286 R369G probably null Het
Ttc41 T C 10: 86,724,374 I387T probably benign Het
Tubgcp6 A G 15: 89,102,984 L1262P probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Zfp804b T C 5: 6,769,445 H1206R probably damaging Het
Other mutations in Kif16b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Kif16b APN 2 142848035 nonsense probably null
IGL00499:Kif16b APN 2 142857324 missense probably damaging 1.00
IGL00913:Kif16b APN 2 142704007 nonsense probably null
IGL00971:Kif16b APN 2 142711744 missense probably benign 0.01
IGL01712:Kif16b APN 2 142648471 missense probably damaging 1.00
IGL01965:Kif16b APN 2 142848405 missense probably damaging 1.00
IGL02428:Kif16b APN 2 142672360 missense possibly damaging 0.88
IGL02576:Kif16b APN 2 142862545 splice site probably benign
IGL02884:Kif16b APN 2 142702614 splice site probably benign
IGL03065:Kif16b APN 2 142619913 missense probably damaging 1.00
IGL03103:Kif16b APN 2 142862488 missense probably damaging 1.00
IGL03403:Kif16b APN 2 142711869 missense probably damaging 1.00
IGL02835:Kif16b UTSW 2 142712213 missense probably benign 0.00
R0058:Kif16b UTSW 2 142857305 splice site probably null
R0058:Kif16b UTSW 2 142857305 splice site probably null
R0081:Kif16b UTSW 2 142707426 splice site probably benign
R0123:Kif16b UTSW 2 142672375 missense probably benign
R0134:Kif16b UTSW 2 142672375 missense probably benign
R0388:Kif16b UTSW 2 142740937 missense probably damaging 1.00
R0396:Kif16b UTSW 2 142853659 missense probably damaging 1.00
R0502:Kif16b UTSW 2 142712155 missense probably benign 0.00
R1027:Kif16b UTSW 2 142854538 splice site probably benign
R1674:Kif16b UTSW 2 142712953 nonsense probably null
R1752:Kif16b UTSW 2 142690666 missense probably benign 0.01
R2154:Kif16b UTSW 2 142690580 missense probably damaging 1.00
R2262:Kif16b UTSW 2 142740917 missense probably damaging 1.00
R3951:Kif16b UTSW 2 142707359 missense probably benign 0.01
R4161:Kif16b UTSW 2 142707404 missense probably benign 0.00
R4697:Kif16b UTSW 2 142690694 missense probably benign 0.09
R4747:Kif16b UTSW 2 142857426 missense probably damaging 1.00
R4808:Kif16b UTSW 2 142857358 missense probably damaging 1.00
R4878:Kif16b UTSW 2 142848003 missense probably damaging 1.00
R5068:Kif16b UTSW 2 142711707 missense probably benign
R5120:Kif16b UTSW 2 142848339 missense probably damaging 1.00
R5358:Kif16b UTSW 2 142740969 missense probably damaging 1.00
R5821:Kif16b UTSW 2 142702666 missense probably damaging 1.00
R5833:Kif16b UTSW 2 142707367 missense probably benign
R5882:Kif16b UTSW 2 142707258 critical splice donor site probably null
R5974:Kif16b UTSW 2 142857381 missense probably damaging 1.00
R6043:Kif16b UTSW 2 142711900 missense probably damaging 1.00
R6230:Kif16b UTSW 2 142849912 missense probably damaging 1.00
R6373:Kif16b UTSW 2 142699698 missense possibly damaging 0.91
R6472:Kif16b UTSW 2 142699948 intron probably benign
R6622:Kif16b UTSW 2 142712442 missense probably benign 0.01
R6654:Kif16b UTSW 2 142701277 intron probably benign
R6912:Kif16b UTSW 2 142700099 intron probably benign
R7003:Kif16b UTSW 2 142758829 missense possibly damaging 0.95
R7265:Kif16b UTSW 2 142714730 missense probably damaging 1.00
R7307:Kif16b UTSW 2 142712931 missense probably benign 0.00
R7376:Kif16b UTSW 2 142711872 missense probably damaging 0.99
R7381:Kif16b UTSW 2 142857423 missense probably damaging 1.00
R7558:Kif16b UTSW 2 142758826 missense probably damaging 1.00
R7681:Kif16b UTSW 2 142756126 missense probably damaging 1.00
R7896:Kif16b UTSW 2 142834075 critical splice donor site probably null
R7956:Kif16b UTSW 2 142862470 missense probably benign 0.00
R8053:Kif16b UTSW 2 142853714 missense probably damaging 1.00
R8056:Kif16b UTSW 2 142712842 missense probably damaging 1.00
R8139:Kif16b UTSW 2 142901365 missense probably benign 0.00
R8182:Kif16b UTSW 2 142712899 missense possibly damaging 0.90
R8224:Kif16b UTSW 2 142834088 missense probably benign 0.03
R8357:Kif16b UTSW 2 142711908 missense probably damaging 1.00
R8359:Kif16b UTSW 2 142711857 missense probably benign 0.05
R8360:Kif16b UTSW 2 142711857 missense probably benign 0.05
R8369:Kif16b UTSW 2 142711857 missense probably benign 0.05
R8385:Kif16b UTSW 2 142712338 missense probably benign 0.09
R8457:Kif16b UTSW 2 142711908 missense probably damaging 1.00
R8720:Kif16b UTSW 2 142849872 missense probably damaging 1.00
R8898:Kif16b UTSW 2 142712979 missense possibly damaging 0.81
R8987:Kif16b UTSW 2 142849863 critical splice donor site probably null
R8987:Kif16b UTSW 2 142901358 missense probably benign 0.00
R9022:Kif16b UTSW 2 142712617 missense possibly damaging 0.46
R9040:Kif16b UTSW 2 142849878 missense probably benign 0.02
R9044:Kif16b UTSW 2 142699657 missense possibly damaging 0.91
R9138:Kif16b UTSW 2 142700556 missense
R9167:Kif16b UTSW 2 142700920 nonsense probably null
R9218:Kif16b UTSW 2 142699663 missense possibly damaging 0.77
R9283:Kif16b UTSW 2 142712980 missense probably benign 0.00
R9300:Kif16b UTSW 2 142699287 missense probably benign
R9378:Kif16b UTSW 2 142619818 nonsense probably null
R9522:Kif16b UTSW 2 142849907 missense probably damaging 0.96
R9588:Kif16b UTSW 2 142711884 missense possibly damaging 0.82
R9632:Kif16b UTSW 2 142712040 missense probably benign 0.00
R9641:Kif16b UTSW 2 142700669 missense probably benign 0.01
X0058:Kif16b UTSW 2 142758861 missense probably damaging 1.00
Z1177:Kif16b UTSW 2 142711824 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGGCATTATAAAGGCTTTCCAGC -3'
(R):5'- TCTCTGCCACTTGAGATTACAGAC -3'

Sequencing Primer
(F):5'- CTTTCCAGCAAGACAGGAGACATG -3'
(R):5'- TGCCACTTGAGATTACAGACTCACAG -3'
Posted On 2014-11-11