Incidental Mutation 'R2401:Acnat1'
ID248676
Institutional Source Beutler Lab
Gene Symbol Acnat1
Ensembl Gene ENSMUSG00000070985
Gene Nameacyl-coenzyme A amino acid N-acyltransferase 1
Synonyms
MMRRC Submission 040367-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R2401 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location49447105-49473912 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 49451077 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 11 (N11K)
Ref Sequence ENSEMBL: ENSMUSP00000121168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095086] [ENSMUST00000107697] [ENSMUST00000135976]
Predicted Effect probably benign
Transcript: ENSMUST00000095086
AA Change: N11K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000092702
Gene: ENSMUSG00000070985
AA Change: N11K

DomainStartEndE-ValueType
Pfam:Bile_Hydr_Trans 15 144 2.2e-44 PFAM
low complexity region 149 162 N/A INTRINSIC
Pfam:Abhydrolase_5 170 360 3.6e-8 PFAM
Pfam:FSH1 191 361 4.5e-7 PFAM
Pfam:BAAT_C 206 411 5.5e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107697
AA Change: N11K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103325
Gene: ENSMUSG00000070985
AA Change: N11K

DomainStartEndE-ValueType
Pfam:Bile_Hydr_Trans 14 145 5.7e-42 PFAM
Pfam:Abhydrolase_5 156 342 3.3e-8 PFAM
Pfam:BAAT_C 188 393 1.6e-74 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000135976
AA Change: N11K

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 120,283,089 L1158P probably damaging Het
Ammecr1l T A 18: 31,776,003 I217N possibly damaging Het
Ankrd11 G A 8: 122,908,734 R54* probably null Het
Ccdc178 C T 18: 22,131,414 probably null Het
Ccdc36 G T 9: 108,413,006 T133N possibly damaging Het
Clcn7 T C 17: 25,153,140 S425P probably benign Het
Cnmd A G 14: 79,656,605 V114A probably damaging Het
Col13a1 T C 10: 61,851,162 T651A unknown Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyp3a25 T C 5: 145,986,968 probably null Het
Dmrta1 A T 4: 89,691,616 D271V probably benign Het
Efcab3 T A 11: 105,072,318 probably null Het
Exo5 T C 4: 120,921,997 I224V probably damaging Het
Fam162b C A 10: 51,587,218 A118S probably damaging Het
Glb1 A G 9: 114,454,257 T406A possibly damaging Het
Grk3 T C 5: 112,914,983 N666S probably benign Het
Hars2 T C 18: 36,789,523 F370L possibly damaging Het
Ighv8-11 T G 12: 115,567,603 probably benign Het
Inpp4b A T 8: 81,997,339 D500V probably benign Het
Itgb4 A G 11: 116,006,563 D1534G possibly damaging Het
Kcnk2 G C 1: 189,340,017 T38S possibly damaging Het
Kif16b C T 2: 142,756,122 V527I probably benign Het
Kmt2b A G 7: 30,576,708 Y1789H probably damaging Het
Lpl A C 8: 68,901,243 D412A possibly damaging Het
Lrrc27 T G 7: 139,223,613 L151R probably damaging Het
Muc3 T C 5: 137,154,041 probably benign Het
Nup205 T A 6: 35,208,134 Y829* probably null Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfm4 A G 14: 80,021,752 Y447C probably damaging Het
Olfr1308 T C 2: 111,960,149 Y308C probably benign Het
Pcdhb6 T C 18: 37,335,169 V381A probably benign Het
Prmt2 C T 10: 76,225,415 W79* probably null Het
Skiv2l T C 17: 34,840,385 M1029V probably benign Het
Stil A G 4: 115,016,286 R369G probably null Het
Ttc41 T C 10: 86,724,374 I387T probably benign Het
Tubgcp6 A G 15: 89,102,984 L1262P probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Zfp804b T C 5: 6,769,445 H1206R probably damaging Het
Other mutations in Acnat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02733:Acnat1 APN 4 49447793 missense probably benign
IGL03241:Acnat1 APN 4 49447702 missense probably benign 0.01
R0478:Acnat1 UTSW 4 49450901 missense probably damaging 1.00
R0568:Acnat1 UTSW 4 49451003 missense possibly damaging 0.93
R1299:Acnat1 UTSW 4 49450925 missense possibly damaging 0.94
R1538:Acnat1 UTSW 4 49447835 missense possibly damaging 0.69
R1750:Acnat1 UTSW 4 49451042 missense probably benign 0.08
R1847:Acnat1 UTSW 4 49447716 missense possibly damaging 0.71
R1913:Acnat1 UTSW 4 49447498 missense probably damaging 1.00
R3195:Acnat1 UTSW 4 49447457 missense probably damaging 1.00
R3196:Acnat1 UTSW 4 49447457 missense probably damaging 1.00
R3948:Acnat1 UTSW 4 49447477 missense possibly damaging 0.52
R4395:Acnat1 UTSW 4 49447679 missense probably benign 0.00
R4598:Acnat1 UTSW 4 49450781 missense probably benign 0.22
R4774:Acnat1 UTSW 4 49450784 missense probably benign 0.08
R6575:Acnat1 UTSW 4 49450785 missense possibly damaging 0.53
R7545:Acnat1 UTSW 4 49449142 nonsense probably null
R7891:Acnat1 UTSW 4 49449181 missense possibly damaging 0.89
R7974:Acnat1 UTSW 4 49449181 missense possibly damaging 0.89
Z1088:Acnat1 UTSW 4 49447588 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACCCCTACATAGTCACC -3'
(R):5'- CTTCAAGATCCTGGTTGGGG -3'

Sequencing Primer
(F):5'- CCCCCAAGGCCGGTGTC -3'
(R):5'- CAAGATCCTGGTTGGGGGAAGG -3'
Posted On2014-11-11