Incidental Mutation 'R2401:Dmrta1'
ID248677
Institutional Source Beutler Lab
Gene Symbol Dmrta1
Ensembl Gene ENSMUSG00000043753
Gene Namedoublesex and mab-3 related transcription factor like family A1
SynonymsDmrt4
MMRRC Submission 040367-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2401 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location89679436-89694772 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89691616 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 271 (D271V)
Ref Sequence ENSEMBL: ENSMUSP00000057488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052478]
Predicted Effect probably benign
Transcript: ENSMUST00000052478
AA Change: D271V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000057488
Gene: ENSMUSG00000043753
AA Change: D271V

DomainStartEndE-ValueType
low complexity region 20 37 N/A INTRINSIC
DM 82 135 2.31e-30 SMART
low complexity region 151 165 N/A INTRINSIC
Pfam:DMA 314 350 3.3e-21 PFAM
low complexity region 393 404 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131576
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (40/40)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile; however, females exhibit polyovular ovarian follicles while 25% of males display abnormal copulatory behavior toward other males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 120,283,089 L1158P probably damaging Het
Acnat1 A T 4: 49,451,077 N11K possibly damaging Het
Ammecr1l T A 18: 31,776,003 I217N possibly damaging Het
Ankrd11 G A 8: 122,908,734 R54* probably null Het
Ccdc178 C T 18: 22,131,414 probably null Het
Ccdc36 G T 9: 108,413,006 T133N possibly damaging Het
Clcn7 T C 17: 25,153,140 S425P probably benign Het
Cnmd A G 14: 79,656,605 V114A probably damaging Het
Col13a1 T C 10: 61,851,162 T651A unknown Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyp3a25 T C 5: 145,986,968 probably null Het
Efcab3 T A 11: 105,072,318 probably null Het
Exo5 T C 4: 120,921,997 I224V probably damaging Het
Fam162b C A 10: 51,587,218 A118S probably damaging Het
Glb1 A G 9: 114,454,257 T406A possibly damaging Het
Grk3 T C 5: 112,914,983 N666S probably benign Het
Hars2 T C 18: 36,789,523 F370L possibly damaging Het
Ighv8-11 T G 12: 115,567,603 probably benign Het
Inpp4b A T 8: 81,997,339 D500V probably benign Het
Itgb4 A G 11: 116,006,563 D1534G possibly damaging Het
Kcnk2 G C 1: 189,340,017 T38S possibly damaging Het
Kif16b C T 2: 142,756,122 V527I probably benign Het
Kmt2b A G 7: 30,576,708 Y1789H probably damaging Het
Lpl A C 8: 68,901,243 D412A possibly damaging Het
Lrrc27 T G 7: 139,223,613 L151R probably damaging Het
Muc3 T C 5: 137,154,041 probably benign Het
Nup205 T A 6: 35,208,134 Y829* probably null Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfm4 A G 14: 80,021,752 Y447C probably damaging Het
Olfr1308 T C 2: 111,960,149 Y308C probably benign Het
Pcdhb6 T C 18: 37,335,169 V381A probably benign Het
Prmt2 C T 10: 76,225,415 W79* probably null Het
Skiv2l T C 17: 34,840,385 M1029V probably benign Het
Stil A G 4: 115,016,286 R369G probably null Het
Ttc41 T C 10: 86,724,374 I387T probably benign Het
Tubgcp6 A G 15: 89,102,984 L1262P probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Zfp804b T C 5: 6,769,445 H1206R probably damaging Het
Other mutations in Dmrta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02154:Dmrta1 APN 4 89691913 missense probably benign 0.04
IGL02572:Dmrta1 APN 4 89691558 missense probably benign 0.01
IGL02875:Dmrta1 APN 4 89691748 missense possibly damaging 0.70
IGL02883:Dmrta1 APN 4 89688774 missense probably benign
R0097:Dmrta1 UTSW 4 89688872 missense probably benign 0.08
R0097:Dmrta1 UTSW 4 89688872 missense probably benign 0.08
R0394:Dmrta1 UTSW 4 89692039 missense probably damaging 1.00
R2093:Dmrta1 UTSW 4 89691505 missense probably benign
R2132:Dmrta1 UTSW 4 89688709 missense probably damaging 1.00
R2133:Dmrta1 UTSW 4 89688709 missense probably damaging 1.00
R3694:Dmrta1 UTSW 4 89692178 nonsense probably null
R3695:Dmrta1 UTSW 4 89692178 nonsense probably null
R3891:Dmrta1 UTSW 4 89691594 missense possibly damaging 0.93
R3892:Dmrta1 UTSW 4 89691594 missense possibly damaging 0.93
R3929:Dmrta1 UTSW 4 89691444 nonsense probably null
R4620:Dmrta1 UTSW 4 89688784 missense probably benign 0.05
R4927:Dmrta1 UTSW 4 89691748 missense probably damaging 1.00
R4982:Dmrta1 UTSW 4 89688564 missense probably damaging 1.00
R5312:Dmrta1 UTSW 4 89692047 missense probably damaging 0.99
R5437:Dmrta1 UTSW 4 89691756 missense possibly damaging 0.71
R5637:Dmrta1 UTSW 4 89688831 missense probably benign
R6185:Dmrta1 UTSW 4 89691768 missense probably damaging 0.97
R6906:Dmrta1 UTSW 4 89691966 missense probably benign 0.06
R7156:Dmrta1 UTSW 4 89688463 missense probably damaging 0.99
R7201:Dmrta1 UTSW 4 89692171 nonsense probably null
R7755:Dmrta1 UTSW 4 89691933 missense probably benign 0.01
R7862:Dmrta1 UTSW 4 89688324 missense probably benign 0.00
R7880:Dmrta1 UTSW 4 89688844 missense possibly damaging 0.95
R7945:Dmrta1 UTSW 4 89688324 missense probably benign 0.00
R7963:Dmrta1 UTSW 4 89688844 missense possibly damaging 0.95
Z1177:Dmrta1 UTSW 4 89688408 missense probably damaging 0.97
Z1177:Dmrta1 UTSW 4 89688454 missense probably benign 0.37
Z1177:Dmrta1 UTSW 4 89688498 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GAGAAACTGTGAGTCATGCCAG -3'
(R):5'- AATAGCTTGGACTACATCTCCC -3'

Sequencing Primer
(F):5'- CTGTGAGTCATGCCAGAGTAGAC -3'
(R):5'- TCCCTTGCAGAACTGTAGAATGC -3'
Posted On2014-11-11