Mutagenetix > Incidental Mutation

Incidental Mutation 'R2401:Dmrta1'

248677

Institutional Source

Beutler Lab

Gene Symbol

Dmrta1

Ensembl Gene

ENSMUSG00000043753

Gene Name

doublesex and mab-3 related transcription factor like family A1

Synonyms

Dmrt4

MMRRC Submission

040367-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2401 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

89679436-89694772 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 89691616 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 271 (D271V)

Ref Sequence

ENSEMBL: ENSMUSP00000057488 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052478]

AlphaFold

Q8CFG4

Predicted Effect

probably benign
Transcript: ENSMUST00000052478
AA Change: D271V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000057488
Gene: ENSMUSG00000043753
AA Change: D271V

Domain	Start	End	E-Value	Type
low complexity region	20	37	N/A	INTRINSIC
DM	82	135	2.31e-30	SMART
low complexity region	151	165	N/A	INTRINSIC
Pfam:DMA	314	350	3.3e-21	PFAM
low complexity region	393	404	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131576

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.0%

Validation Efficiency

100% (40/40)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile; however, females exhibit polyovular ovarian follicles while 25% of males display abnormal copulatory behavior toward other males. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	T	C	7: 120,283,089	L1158P	probably damaging	Het
Acnat1	A	T	4: 49,451,077	N11K	possibly damaging	Het
Ammecr1l	T	A	18: 31,776,003	I217N	possibly damaging	Het
Ankrd11	G	A	8: 122,908,734	R54*	probably null	Het
Ccdc178	C	T	18: 22,131,414		probably null	Het
Ccdc36	G	T	9: 108,413,006	T133N	possibly damaging	Het
Clcn7	T	C	17: 25,153,140	S425P	probably benign	Het
Cnmd	A	G	14: 79,656,605	V114A	probably damaging	Het
Col13a1	T	C	10: 61,851,162	T651A	unknown	Het
Col1a2	G	A	6: 4,518,822		probably benign	Het
Cyp3a25	T	C	5: 145,986,968		probably null	Het
Efcab3	T	A	11: 105,072,318		probably null	Het
Exo5	T	C	4: 120,921,997	I224V	probably damaging	Het
Fam162b	C	A	10: 51,587,218	A118S	probably damaging	Het
Glb1	A	G	9: 114,454,257	T406A	possibly damaging	Het
Grk3	T	C	5: 112,914,983	N666S	probably benign	Het
Hars2	T	C	18: 36,789,523	F370L	possibly damaging	Het
Ighv8-11	T	G	12: 115,567,603		probably benign	Het
Inpp4b	A	T	8: 81,997,339	D500V	probably benign	Het
Itgb4	A	G	11: 116,006,563	D1534G	possibly damaging	Het
Kcnk2	G	C	1: 189,340,017	T38S	possibly damaging	Het
Kif16b	C	T	2: 142,756,122	V527I	probably benign	Het
Kmt2b	A	G	7: 30,576,708	Y1789H	probably damaging	Het
Lpl	A	C	8: 68,901,243	D412A	possibly damaging	Het
Lrrc27	T	G	7: 139,223,613	L151R	probably damaging	Het
Muc3	T	C	5: 137,154,041		probably benign	Het
Nup205	T	A	6: 35,208,134	Y829*	probably null	Het
Obscn	T	C	11: 59,131,646	R758G	possibly damaging	Het
Olfm4	A	G	14: 80,021,752	Y447C	probably damaging	Het
Olfr1308	T	C	2: 111,960,149	Y308C	probably benign	Het
Pcdhb6	T	C	18: 37,335,169	V381A	probably benign	Het
Prmt2	C	T	10: 76,225,415	W79*	probably null	Het
Skiv2l	T	C	17: 34,840,385	M1029V	probably benign	Het
Stil	A	G	4: 115,016,286	R369G	probably null	Het
Ttc41	T	C	10: 86,724,374	I387T	probably benign	Het
Tubgcp6	A	G	15: 89,102,984	L1262P	probably benign	Het
Vmn2r112	T	A	17: 22,603,115	V258E	probably damaging	Het
Zfp804b	T	C	5: 6,769,445	H1206R	probably damaging	Het

Other mutations in Dmrta1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02154:Dmrta1	APN	4	89691913	missense	probably benign	0.04
IGL02572:Dmrta1	APN	4	89691558	missense	probably benign	0.01
IGL02875:Dmrta1	APN	4	89691748	missense	possibly damaging	0.70
IGL02883:Dmrta1	APN	4	89688774	missense	probably benign
R0097:Dmrta1	UTSW	4	89688872	missense	probably benign	0.08
R0097:Dmrta1	UTSW	4	89688872	missense	probably benign	0.08
R0394:Dmrta1	UTSW	4	89692039	missense	probably damaging	1.00
R2093:Dmrta1	UTSW	4	89691505	missense	probably benign
R2132:Dmrta1	UTSW	4	89688709	missense	probably damaging	1.00
R2133:Dmrta1	UTSW	4	89688709	missense	probably damaging	1.00
R3694:Dmrta1	UTSW	4	89692178	nonsense	probably null
R3695:Dmrta1	UTSW	4	89692178	nonsense	probably null
R3891:Dmrta1	UTSW	4	89691594	missense	possibly damaging	0.93
R3892:Dmrta1	UTSW	4	89691594	missense	possibly damaging	0.93
R3929:Dmrta1	UTSW	4	89691444	nonsense	probably null
R4620:Dmrta1	UTSW	4	89688784	missense	probably benign	0.05
R4927:Dmrta1	UTSW	4	89691748	missense	probably damaging	1.00
R4982:Dmrta1	UTSW	4	89688564	missense	probably damaging	1.00
R5312:Dmrta1	UTSW	4	89692047	missense	probably damaging	0.99
R5437:Dmrta1	UTSW	4	89691756	missense	possibly damaging	0.71
R5637:Dmrta1	UTSW	4	89688831	missense	probably benign
R6185:Dmrta1	UTSW	4	89691768	missense	probably damaging	0.97
R6906:Dmrta1	UTSW	4	89691966	missense	probably benign	0.06
R7156:Dmrta1	UTSW	4	89688463	missense	probably damaging	0.99
R7201:Dmrta1	UTSW	4	89692171	nonsense	probably null
R7755:Dmrta1	UTSW	4	89691933	missense	probably benign	0.01
R7862:Dmrta1	UTSW	4	89688324	missense	probably benign	0.00
R7880:Dmrta1	UTSW	4	89688844	missense	possibly damaging	0.95
R8714:Dmrta1	UTSW	4	89691445	missense	probably benign
R8841:Dmrta1	UTSW	4	89691713	missense	probably benign	0.00
R9028:Dmrta1	UTSW	4	89691677	missense	probably damaging	0.96
Z1177:Dmrta1	UTSW	4	89688408	missense	probably damaging	0.97
Z1177:Dmrta1	UTSW	4	89688454	missense	probably benign	0.37
Z1177:Dmrta1	UTSW	4	89688498	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- GAGAAACTGTGAGTCATGCCAG -3'
(R):5'- AATAGCTTGGACTACATCTCCC -3'

Sequencing Primer
(F):5'- CTGTGAGTCATGCCAGAGTAGAC -3'
(R):5'- TCCCTTGCAGAACTGTAGAATGC -3'

Posted On

2014-11-11