Incidental Mutation 'R2401:Stil'
ID 248678
Institutional Source Beutler Lab
Gene Symbol Stil
Ensembl Gene ENSMUSG00000028718
Gene Name Scl/Tal1 interrupting locus
Synonyms Sil
MMRRC Submission 040367-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2401 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 115000159-115043196 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 115016286 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 369 (R369G)
Ref Sequence ENSEMBL: ENSMUSP00000030490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030490] [ENSMUST00000129957] [ENSMUST00000141933] [ENSMUST00000147519]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000030490
AA Change: R369G

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030490
Gene: ENSMUSG00000028718
AA Change: R369G

DomainStartEndE-ValueType
Pfam:STIL_N 22 426 5.1e-199 PFAM
low complexity region 709 724 N/A INTRINSIC
low complexity region 1106 1118 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000129957
AA Change: R369G

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000123385
Gene: ENSMUSG00000028718
AA Change: R369G

DomainStartEndE-ValueType
Pfam:STIL_N 22 416 1.5e-180 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130401
Predicted Effect possibly damaging
Transcript: ENSMUST00000141933
AA Change: R369G

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000118849
Gene: ENSMUSG00000028718
AA Change: R369G

DomainStartEndE-ValueType
Pfam:STIL_N 22 392 6.6e-166 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144316
Predicted Effect probably benign
Transcript: ENSMUST00000147519
SMART Domains Protein: ENSMUSP00000120836
Gene: ENSMUSG00000028718

DomainStartEndE-ValueType
Pfam:STIL_N 1 78 5.3e-34 PFAM
Meta Mutation Damage Score 0.0929 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: This gene encodes a centrosomal protein ubiquitously expressed in proliferating cells and during early embryonic development. Mice lacking the encoded protein die in utero with marked growth retardation, defects in the developing neural fold and randomization of left-right asymmetry. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos with various neural tube defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 120,283,089 L1158P probably damaging Het
Acnat1 A T 4: 49,451,077 N11K possibly damaging Het
Ammecr1l T A 18: 31,776,003 I217N possibly damaging Het
Ankrd11 G A 8: 122,908,734 R54* probably null Het
Ccdc178 C T 18: 22,131,414 probably null Het
Ccdc36 G T 9: 108,413,006 T133N possibly damaging Het
Clcn7 T C 17: 25,153,140 S425P probably benign Het
Cnmd A G 14: 79,656,605 V114A probably damaging Het
Col13a1 T C 10: 61,851,162 T651A unknown Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyp3a25 T C 5: 145,986,968 probably null Het
Dmrta1 A T 4: 89,691,616 D271V probably benign Het
Efcab3 T A 11: 105,072,318 probably null Het
Exo5 T C 4: 120,921,997 I224V probably damaging Het
Fam162b C A 10: 51,587,218 A118S probably damaging Het
Glb1 A G 9: 114,454,257 T406A possibly damaging Het
Grk3 T C 5: 112,914,983 N666S probably benign Het
Hars2 T C 18: 36,789,523 F370L possibly damaging Het
Ighv8-11 T G 12: 115,567,603 probably benign Het
Inpp4b A T 8: 81,997,339 D500V probably benign Het
Itgb4 A G 11: 116,006,563 D1534G possibly damaging Het
Kcnk2 G C 1: 189,340,017 T38S possibly damaging Het
Kif16b C T 2: 142,756,122 V527I probably benign Het
Kmt2b A G 7: 30,576,708 Y1789H probably damaging Het
Lpl A C 8: 68,901,243 D412A possibly damaging Het
Lrrc27 T G 7: 139,223,613 L151R probably damaging Het
Muc3 T C 5: 137,154,041 probably benign Het
Nup205 T A 6: 35,208,134 Y829* probably null Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfm4 A G 14: 80,021,752 Y447C probably damaging Het
Olfr1308 T C 2: 111,960,149 Y308C probably benign Het
Pcdhb6 T C 18: 37,335,169 V381A probably benign Het
Prmt2 C T 10: 76,225,415 W79* probably null Het
Skiv2l T C 17: 34,840,385 M1029V probably benign Het
Ttc41 T C 10: 86,724,374 I387T probably benign Het
Tubgcp6 A G 15: 89,102,984 L1262P probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Zfp804b T C 5: 6,769,445 H1206R probably damaging Het
Other mutations in Stil
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01506:Stil APN 4 115024112 missense probably benign 0.29
IGL01672:Stil APN 4 115032789 missense probably damaging 1.00
IGL02058:Stil APN 4 115014162 missense probably benign 0.00
IGL02076:Stil APN 4 115023637 missense probably benign 0.03
IGL02104:Stil APN 4 115041482 missense probably damaging 1.00
IGL02355:Stil APN 4 115010111 missense probably damaging 1.00
IGL02362:Stil APN 4 115010111 missense probably damaging 1.00
IGL02612:Stil APN 4 115023696 missense possibly damaging 0.80
IGL02695:Stil APN 4 115016175 missense probably damaging 1.00
IGL02696:Stil APN 4 115041495 missense probably damaging 0.99
IGL02826:Stil APN 4 115024098 missense probably benign 0.01
IGL02946:Stil APN 4 115029913 missense probably benign 0.05
IGL03146:Stil APN 4 115024415 missense probably damaging 1.00
BB005:Stil UTSW 4 115030001 missense probably damaging 0.98
BB015:Stil UTSW 4 115030001 missense probably damaging 0.98
R0058:Stil UTSW 4 115041298 missense probably damaging 1.00
R0256:Stil UTSW 4 115023685 missense possibly damaging 0.80
R0324:Stil UTSW 4 115039149 missense probably benign 0.01
R0391:Stil UTSW 4 115041172 critical splice acceptor site probably null
R0602:Stil UTSW 4 115024423 splice site probably benign
R0620:Stil UTSW 4 115007159 missense possibly damaging 0.52
R1452:Stil UTSW 4 115039195 missense probably benign 0.00
R1462:Stil UTSW 4 115023964 missense probably benign 0.00
R1462:Stil UTSW 4 115023964 missense probably benign 0.00
R1544:Stil UTSW 4 115023852 missense probably damaging 0.97
R1789:Stil UTSW 4 115041782 missense probably benign 0.01
R1878:Stil UTSW 4 115041226 missense probably damaging 1.00
R1895:Stil UTSW 4 115023875 missense probably benign 0.40
R2325:Stil UTSW 4 115032707 missense probably benign 0.12
R3054:Stil UTSW 4 115004966 missense probably damaging 1.00
R3055:Stil UTSW 4 115014069 splice site probably benign
R4097:Stil UTSW 4 115023600 missense probably benign 0.04
R4330:Stil UTSW 4 115004979 missense probably damaging 1.00
R4418:Stil UTSW 4 115009377 missense probably benign 0.17
R4665:Stil UTSW 4 115041644 missense probably benign 0.00
R4688:Stil UTSW 4 115041308 missense probably damaging 1.00
R4740:Stil UTSW 4 115006782 missense probably benign 0.15
R4860:Stil UTSW 4 115038474 missense probably benign 0.01
R4860:Stil UTSW 4 115038474 missense probably benign 0.01
R4909:Stil UTSW 4 115024225 nonsense probably null
R6130:Stil UTSW 4 115029861 splice site probably null
R6523:Stil UTSW 4 115032714 frame shift probably null
R7294:Stil UTSW 4 115007283 missense probably benign 0.17
R7357:Stil UTSW 4 115014226 critical splice donor site probably null
R7387:Stil UTSW 4 115024036 missense probably benign 0.37
R7592:Stil UTSW 4 115023808 missense probably benign 0.00
R7776:Stil UTSW 4 115032838 missense possibly damaging 0.49
R7908:Stil UTSW 4 115032699 missense possibly damaging 0.68
R7928:Stil UTSW 4 115030001 missense probably damaging 0.98
R9064:Stil UTSW 4 115041735 missense probably benign 0.00
R9140:Stil UTSW 4 115007252 missense probably damaging 1.00
R9500:Stil UTSW 4 115021519 missense possibly damaging 0.93
R9695:Stil UTSW 4 115024181 missense probably damaging 1.00
R9697:Stil UTSW 4 115021504 missense probably benign 0.45
Z1088:Stil UTSW 4 115006693 missense probably damaging 1.00
Z1177:Stil UTSW 4 115041379 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCTACTGTTCGGATAAATGGGG -3'
(R):5'- GCTGAGTTTATCAAGCAACTACCAG -3'

Sequencing Primer
(F):5'- CGGATAAATGGGGTTCTTTGC -3'
(R):5'- TAGGGGTAAAGCATGCCTCCAC -3'
Posted On 2014-11-11