Mutagenetix > Incidental Mutation

Incidental Mutation 'R2401:Grk3'

248681

Institutional Source

Beutler Lab

Gene Symbol

Grk3

Ensembl Gene

ENSMUSG00000042249

Gene Name

G protein-coupled receptor kinase 3

Synonyms

4833444A01Rik, Bark-2, Adrbk-2, Adrbk2, beta ARK2

MMRRC Submission

040367-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2401 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

112910482-113015791 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 112914983 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 666 (N666S)

Ref Sequence

ENSEMBL: ENSMUSP00000070445 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065167] [ENSMUST00000197888] [ENSMUST00000200332]

AlphaFold

Q3UYH7

Predicted Effect

probably benign
Transcript: ENSMUST00000065167
AA Change: N666S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000070445
Gene: ENSMUSG00000042249
AA Change: N666S

Domain	Start	End	E-Value	Type
RGS	54	175	1.44e-28	SMART
S_TKc	191	453	8.94e-85	SMART
S_TK_X	454	530	2.19e-10	SMART
PH	559	654	8.45e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000197888

SMART Domains

Protein: ENSMUSP00000142968
Gene: ENSMUSG00000042249

Domain	Start	End	E-Value	Type
RGS	12	133	1.44e-28	SMART
S_TKc	149	411	8.94e-85	SMART
S_TK_X	412	488	2.19e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199337

Predicted Effect

probably benign
Transcript: ENSMUST00000200332

SMART Domains

Protein: ENSMUSP00000142926
Gene: ENSMUSG00000042249

Domain	Start	End	E-Value	Type
PDB:3V5W\|A	1	88	6e-42	PDB
SCOP:d1dk8a_	48	88	2e-4	SMART
Blast:RGS	54	88	1e-18	BLAST

Meta Mutation Damage Score

0.0586

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.0%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The beta-adrenergic receptor kinase specifically phosphorylates the agonist-occupied form of the beta-adrenergic and related G protein-coupled receptors. Overall, the beta adrenergic receptor kinase 2 has 85% amino acid similarity with beta adrenergic receptor kinase 1, with the protein kinase catalytic domain having 95% similarity. These data suggest the existence of a family of receptor kinases which may serve broadly to regulate receptor function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Animals homozygous for a mutation of this gene appear normal and are fertile, but exhibit a lack of odorant receptor-mediated desensitization in the olfactory epithelium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	T	C	7: 120,283,089	L1158P	probably damaging	Het
Acnat1	A	T	4: 49,451,077	N11K	possibly damaging	Het
Ammecr1l	T	A	18: 31,776,003	I217N	possibly damaging	Het
Ankrd11	G	A	8: 122,908,734	R54*	probably null	Het
Ccdc178	C	T	18: 22,131,414		probably null	Het
Ccdc36	G	T	9: 108,413,006	T133N	possibly damaging	Het
Clcn7	T	C	17: 25,153,140	S425P	probably benign	Het
Cnmd	A	G	14: 79,656,605	V114A	probably damaging	Het
Col13a1	T	C	10: 61,851,162	T651A	unknown	Het
Col1a2	G	A	6: 4,518,822		probably benign	Het
Cyp3a25	T	C	5: 145,986,968		probably null	Het
Dmrta1	A	T	4: 89,691,616	D271V	probably benign	Het
Efcab3	T	A	11: 105,072,318		probably null	Het
Exo5	T	C	4: 120,921,997	I224V	probably damaging	Het
Fam162b	C	A	10: 51,587,218	A118S	probably damaging	Het
Glb1	A	G	9: 114,454,257	T406A	possibly damaging	Het
Hars2	T	C	18: 36,789,523	F370L	possibly damaging	Het
Ighv8-11	T	G	12: 115,567,603		probably benign	Het
Inpp4b	A	T	8: 81,997,339	D500V	probably benign	Het
Itgb4	A	G	11: 116,006,563	D1534G	possibly damaging	Het
Kcnk2	G	C	1: 189,340,017	T38S	possibly damaging	Het
Kif16b	C	T	2: 142,756,122	V527I	probably benign	Het
Kmt2b	A	G	7: 30,576,708	Y1789H	probably damaging	Het
Lpl	A	C	8: 68,901,243	D412A	possibly damaging	Het
Lrrc27	T	G	7: 139,223,613	L151R	probably damaging	Het
Muc3	T	C	5: 137,154,041		probably benign	Het
Nup205	T	A	6: 35,208,134	Y829*	probably null	Het
Obscn	T	C	11: 59,131,646	R758G	possibly damaging	Het
Olfm4	A	G	14: 80,021,752	Y447C	probably damaging	Het
Olfr1308	T	C	2: 111,960,149	Y308C	probably benign	Het
Pcdhb6	T	C	18: 37,335,169	V381A	probably benign	Het
Prmt2	C	T	10: 76,225,415	W79*	probably null	Het
Skiv2l	T	C	17: 34,840,385	M1029V	probably benign	Het
Stil	A	G	4: 115,016,286	R369G	probably null	Het
Ttc41	T	C	10: 86,724,374	I387T	probably benign	Het
Tubgcp6	A	G	15: 89,102,984	L1262P	probably benign	Het
Vmn2r112	T	A	17: 22,603,115	V258E	probably damaging	Het
Zfp804b	T	C	5: 6,769,445	H1206R	probably damaging	Het

Other mutations in Grk3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00974:Grk3	APN	5	112985819	missense	probably damaging	1.00
IGL01359:Grk3	APN	5	112937760	missense	probably damaging	1.00
IGL02318:Grk3	APN	5	112937803	missense	probably damaging	1.00
IGL02612:Grk3	APN	5	112969234	missense	probably benign	0.27
R0142:Grk3	UTSW	5	112915053	missense	probably damaging	1.00
R0589:Grk3	UTSW	5	112928763	splice site	probably benign
R0607:Grk3	UTSW	5	112920053	missense	probably damaging	1.00
R1459:Grk3	UTSW	5	112915012	missense	probably benign	0.10
R1554:Grk3	UTSW	5	112969269	missense	possibly damaging	0.76
R1640:Grk3	UTSW	5	113015382	missense	probably benign	0.36
R1657:Grk3	UTSW	5	112966982	missense	probably damaging	1.00
R1789:Grk3	UTSW	5	112941718	missense	probably damaging	1.00
R3735:Grk3	UTSW	5	112953831	missense	probably benign	0.00
R4024:Grk3	UTSW	5	112914984	missense	possibly damaging	0.77
R4025:Grk3	UTSW	5	112914984	missense	possibly damaging	0.77
R4392:Grk3	UTSW	5	112920136	missense	probably damaging	1.00
R4439:Grk3	UTSW	5	112946677	splice site	probably null
R4589:Grk3	UTSW	5	112941718	missense	possibly damaging	0.87
R4646:Grk3	UTSW	5	112929720	missense	probably benign	0.04
R5154:Grk3	UTSW	5	112941717	missense	probably damaging	1.00
R5462:Grk3	UTSW	5	112969208	missense	probably damaging	1.00
R5764:Grk3	UTSW	5	112966910	critical splice donor site	probably null
R5790:Grk3	UTSW	5	112966976	missense	possibly damaging	0.80
R6516:Grk3	UTSW	5	112961549	intron	probably benign
R6848:Grk3	UTSW	5	112985775	missense	probably damaging	0.98
R7857:Grk3	UTSW	5	112961561	missense	unknown
R7873:Grk3	UTSW	5	112929686	missense	probably benign	0.03
R8029:Grk3	UTSW	5	112961642	missense	probably benign
R8132:Grk3	UTSW	5	112961489	missense	unknown
R8903:Grk3	UTSW	5	112918831	missense	possibly damaging	0.89
R9450:Grk3	UTSW	5	112915047	missense	probably benign	0.06
R9794:Grk3	UTSW	5	112973582	critical splice acceptor site	probably null
RF021:Grk3	UTSW	5	112941688	missense	probably benign	0.20
Z1176:Grk3	UTSW	5	112957314	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- AGTGCTCAGAAACACTGTGTC -3'
(R):5'- TTGTCTCACCAGGTTCCCAG -3'

Sequencing Primer
(F):5'- GTGCTCAGAAACACTGTGTCTTAGC -3'
(R):5'- CAGGCTTCATTCAGTGCAGG -3'

Posted On

2014-11-11