Mutagenetix > Incidental Mutation

Incidental Mutation 'R2401:Nup205'

248687

Institutional Source

Beutler Lab

Gene Symbol

Nup205

Ensembl Gene

ENSMUSG00000038759

Gene Name

nucleoporin 205

Synonyms

3830404O05Rik

MMRRC Submission

040367-MU

Accession Numbers

NCBI RefSeq: NM_027513.1; MGI:2141625

Essential gene?

Probably essential (E-score: 0.964) question?

Stock #

R2401 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

35177421-35247596 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 35208134 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 829 (Y829*)

Ref Sequence

ENSEMBL: ENSMUSP00000144126 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043815] [ENSMUST00000170234] [ENSMUST00000201374]

AlphaFold

A0A0J9YUD5

Predicted Effect

probably null
Transcript: ENSMUST00000043815
AA Change: Y776*

SMART Domains

Protein: ENSMUSP00000039656
Gene: ENSMUSG00000038759
AA Change: Y776*

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
Pfam:Nup192	14	1684	N/A	PFAM
low complexity region	1995	2005	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170234

SMART Domains

Protein: ENSMUSP00000130033
Gene: ENSMUSG00000038759

Domain	Start	End	E-Value	Type
Pfam:DUF3414	13	322	9.7e-98	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000201374
AA Change: Y829*

SMART Domains

Protein: ENSMUSP00000144126
Gene: ENSMUSG00000038759
AA Change: Y829*

Domain	Start	End	E-Value	Type
low complexity region	36	50	N/A	INTRINSIC
Pfam:Nup192	67	1737	N/A	PFAM
low complexity region	2048	2058	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201609

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202898

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.0%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleoporin, which is a subunit of the nuclear pore complex that functions in active transport of proteins, RNAs and ribonucleoprotein particles between the nucleus and cytoplasm. Mutations in this gene are associated with steroid-resistant nephrotic syndrome. [provided by RefSeq, Jul 2016]

Allele List at MGI

All alleles(32) : Targeted(2) Gene trapped(30)

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	T	C	7: 120,283,089	L1158P	probably damaging	Het
Acnat1	A	T	4: 49,451,077	N11K	possibly damaging	Het
Ammecr1l	T	A	18: 31,776,003	I217N	possibly damaging	Het
Ankrd11	G	A	8: 122,908,734	R54*	probably null	Het
Ccdc178	C	T	18: 22,131,414		probably null	Het
Ccdc36	G	T	9: 108,413,006	T133N	possibly damaging	Het
Clcn7	T	C	17: 25,153,140	S425P	probably benign	Het
Cnmd	A	G	14: 79,656,605	V114A	probably damaging	Het
Col13a1	T	C	10: 61,851,162	T651A	unknown	Het
Col1a2	G	A	6: 4,518,822		probably benign	Het
Cyp3a25	T	C	5: 145,986,968		probably null	Het
Dmrta1	A	T	4: 89,691,616	D271V	probably benign	Het
Efcab3	T	A	11: 105,072,318		probably null	Het
Exo5	T	C	4: 120,921,997	I224V	probably damaging	Het
Fam162b	C	A	10: 51,587,218	A118S	probably damaging	Het
Glb1	A	G	9: 114,454,257	T406A	possibly damaging	Het
Grk3	T	C	5: 112,914,983	N666S	probably benign	Het
Hars2	T	C	18: 36,789,523	F370L	possibly damaging	Het
Ighv8-11	T	G	12: 115,567,603		probably benign	Het
Inpp4b	A	T	8: 81,997,339	D500V	probably benign	Het
Itgb4	A	G	11: 116,006,563	D1534G	possibly damaging	Het
Kcnk2	G	C	1: 189,340,017	T38S	possibly damaging	Het
Kif16b	C	T	2: 142,756,122	V527I	probably benign	Het
Kmt2b	A	G	7: 30,576,708	Y1789H	probably damaging	Het
Lpl	A	C	8: 68,901,243	D412A	possibly damaging	Het
Lrrc27	T	G	7: 139,223,613	L151R	probably damaging	Het
Muc3	T	C	5: 137,154,041		probably benign	Het
Obscn	T	C	11: 59,131,646	R758G	possibly damaging	Het
Olfm4	A	G	14: 80,021,752	Y447C	probably damaging	Het
Olfr1308	T	C	2: 111,960,149	Y308C	probably benign	Het
Pcdhb6	T	C	18: 37,335,169	V381A	probably benign	Het
Prmt2	C	T	10: 76,225,415	W79*	probably null	Het
Skiv2l	T	C	17: 34,840,385	M1029V	probably benign	Het
Stil	A	G	4: 115,016,286	R369G	probably null	Het
Ttc41	T	C	10: 86,724,374	I387T	probably benign	Het
Tubgcp6	A	G	15: 89,102,984	L1262P	probably benign	Het
Vmn2r112	T	A	17: 22,603,115	V258E	probably damaging	Het
Zfp804b	T	C	5: 6,769,445	H1206R	probably damaging	Het

Other mutations in Nup205

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Nup205	APN	6	35214802	missense	probably damaging	1.00
IGL01086:Nup205	APN	6	35208936	splice site	probably benign
IGL01138:Nup205	APN	6	35208084	nonsense	probably null
IGL01333:Nup205	APN	6	35241063	missense	probably benign
IGL01399:Nup205	APN	6	35219689	missense	possibly damaging	0.80
IGL01466:Nup205	APN	6	35199959	missense	probably benign	0.08
IGL01913:Nup205	APN	6	35227430	missense	probably benign	0.10
IGL02159:Nup205	APN	6	35189178	missense	probably damaging	1.00
IGL02442:Nup205	APN	6	35190068	missense	probably benign	0.01
IGL02447:Nup205	APN	6	35227576	splice site	probably null
IGL02558:Nup205	APN	6	35189924	missense	probably damaging	1.00
IGL03306:Nup205	APN	6	35208169	missense	probably damaging	0.98
IGL03328:Nup205	APN	6	35232414	missense	probably damaging	0.99
Figaro	UTSW	6	35196714	splice site	probably null
Marcellina	UTSW	6	35183969	missense	probably damaging	1.00
Spirit	UTSW	6	35232408	missense	probably damaging	0.98
Susanna	UTSW	6	35208109	missense	possibly damaging	0.94
voyager	UTSW	6	35189885	missense	possibly damaging	0.80
BB007:Nup205	UTSW	6	35194576	missense	probably damaging	0.98
BB017:Nup205	UTSW	6	35194576	missense	probably damaging	0.98
P0012:Nup205	UTSW	6	35196543	missense	possibly damaging	0.90
R0102:Nup205	UTSW	6	35225780	splice site	probably benign
R0102:Nup205	UTSW	6	35225780	splice site	probably benign
R0362:Nup205	UTSW	6	35196714	splice site	probably null
R0374:Nup205	UTSW	6	35208837	missense	probably damaging	1.00
R0415:Nup205	UTSW	6	35214634	splice site	probably benign
R0427:Nup205	UTSW	6	35194463	missense	probably benign	0.01
R0543:Nup205	UTSW	6	35198969	missense	probably benign
R0611:Nup205	UTSW	6	35225968	missense	probably null	1.00
R0761:Nup205	UTSW	6	35196428	splice site	probably benign
R0828:Nup205	UTSW	6	35194566	missense	probably benign
R0906:Nup205	UTSW	6	35236892	missense	probably damaging	1.00
R1023:Nup205	UTSW	6	35234706	missense	probably damaging	0.98
R1033:Nup205	UTSW	6	35227442	missense	probably benign
R1375:Nup205	UTSW	6	35200071	splice site	probably benign
R1447:Nup205	UTSW	6	35215185	missense	probably benign	0.00
R1468:Nup205	UTSW	6	35225982	critical splice donor site	probably null
R1468:Nup205	UTSW	6	35225982	critical splice donor site	probably null
R1625:Nup205	UTSW	6	35191943	missense	probably benign	0.31
R1652:Nup205	UTSW	6	35238966	missense	probably benign
R1659:Nup205	UTSW	6	35234788	missense	probably benign	0.02
R1693:Nup205	UTSW	6	35210971	missense	probably benign	0.05
R1769:Nup205	UTSW	6	35205431	missense	probably damaging	1.00
R1839:Nup205	UTSW	6	35219714	missense	probably benign	0.00
R1959:Nup205	UTSW	6	35233366	missense	probably benign	0.16
R2051:Nup205	UTSW	6	35230516	missense	probably benign	0.29
R2267:Nup205	UTSW	6	35241349	missense	possibly damaging	0.67
R3697:Nup205	UTSW	6	35188711	missense	probably benign	0.15
R3938:Nup205	UTSW	6	35219742	missense	probably damaging	1.00
R4074:Nup205	UTSW	6	35192040	critical splice donor site	probably null
R4117:Nup205	UTSW	6	35241012	nonsense	probably null
R4364:Nup205	UTSW	6	35192027	missense	probably benign	0.38
R4366:Nup205	UTSW	6	35192027	missense	probably benign	0.38
R4594:Nup205	UTSW	6	35196489	missense	probably benign	0.00
R4706:Nup205	UTSW	6	35202008	missense	probably damaging	1.00
R4787:Nup205	UTSW	6	35202061	missense	probably damaging	1.00
R4849:Nup205	UTSW	6	35230570	missense	possibly damaging	0.90
R4850:Nup205	UTSW	6	35230530	missense	probably benign	0.16
R4943:Nup205	UTSW	6	35224639	missense	probably damaging	1.00
R4966:Nup205	UTSW	6	35243849	missense	probably benign	0.00
R5138:Nup205	UTSW	6	35225866	missense	probably damaging	1.00
R5251:Nup205	UTSW	6	35196482	splice site	probably null
R5444:Nup205	UTSW	6	35189189	missense	probably damaging	0.98
R5760:Nup205	UTSW	6	35247343	missense	probably damaging	1.00
R5762:Nup205	UTSW	6	35227680	missense	probably damaging	1.00
R5762:Nup205	UTSW	6	35230548	missense	probably damaging	0.96
R5941:Nup205	UTSW	6	35232408	missense	probably damaging	0.98
R5969:Nup205	UTSW	6	35177578	unclassified	probably benign
R6003:Nup205	UTSW	6	35212816	missense	probably benign
R6178:Nup205	UTSW	6	35243843	missense	possibly damaging	0.85
R6315:Nup205	UTSW	6	35236869	missense	probably damaging	1.00
R6392:Nup205	UTSW	6	35189885	missense	possibly damaging	0.80
R6710:Nup205	UTSW	6	35247373	missense	probably benign	0.00
R6954:Nup205	UTSW	6	35208109	missense	possibly damaging	0.94
R7022:Nup205	UTSW	6	35243936	missense	probably benign	0.45
R7041:Nup205	UTSW	6	35224535	missense	possibly damaging	0.49
R7052:Nup205	UTSW	6	35215142	missense	possibly damaging	0.81
R7310:Nup205	UTSW	6	35225969	missense	possibly damaging	0.78
R7363:Nup205	UTSW	6	35232573	missense	probably benign	0.28
R7399:Nup205	UTSW	6	35214676	missense	probably damaging	0.99
R7428:Nup205	UTSW	6	35227559	missense	probably damaging	1.00
R7553:Nup205	UTSW	6	35201999	missense	probably damaging	1.00
R7665:Nup205	UTSW	6	35177620	missense	possibly damaging	0.46
R7841:Nup205	UTSW	6	35247437	missense	unknown
R7930:Nup205	UTSW	6	35194576	missense	probably damaging	0.98
R7973:Nup205	UTSW	6	35245339	missense	probably benign
R7976:Nup205	UTSW	6	35198953	missense	probably damaging	1.00
R8073:Nup205	UTSW	6	35202169	critical splice donor site	probably null
R8080:Nup205	UTSW	6	35227376	missense	probably damaging	1.00
R8118:Nup205	UTSW	6	35230516	missense	probably benign	0.29
R8213:Nup205	UTSW	6	35225203	missense	probably benign	0.26
R8237:Nup205	UTSW	6	35227503	missense	possibly damaging	0.89
R8408:Nup205	UTSW	6	35225247	missense	probably damaging	1.00
R8807:Nup205	UTSW	6	35183969	missense	probably damaging	1.00
R8812:Nup205	UTSW	6	35214334	missense	probably damaging	1.00
R9061:Nup205	UTSW	6	35219873	intron	probably benign
R9261:Nup205	UTSW	6	35199857	missense	probably benign	0.00
R9403:Nup205	UTSW	6	35199974	missense	probably benign	0.45
R9648:Nup205	UTSW	6	35225811	missense	probably benign	0.00
R9744:Nup205	UTSW	6	35232575	missense	probably damaging	0.99
R9800:Nup205	UTSW	6	35186533	missense	possibly damaging	0.85
Z1177:Nup205	UTSW	6	35177605	missense	unknown
Z1177:Nup205	UTSW	6	35208793	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- CCTTTGGCAAAATGAAACAAGG -3'
(R):5'- GATTGATGCGCACATGAGAGC -3'

Sequencing Primer
(F):5'- CAAGGTGAATTAAGATTGTGTTGC -3'
(R):5'- AGAACCCAGACATCCTATTTTCTC -3'

Posted On

2014-11-11