Mutagenetix > Incidental Mutation

Incidental Mutation 'R2401:Kmt2b'

248688

Institutional Source

Beutler Lab

Gene Symbol

Kmt2b

Ensembl Gene

ENSMUSG00000006307

Gene Name

lysine (K)-specific methyltransferase 2B

Synonyms

2610014H22Rik, Wbp7, Mll2

MMRRC Submission

040367-MU

Accession Numbers

Genbank: NM_029274; MGI: 109565

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2401 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30568858-30588726 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 30576708 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 1789 (Y1789H)

Ref Sequence

ENSEMBL: ENSMUSP00000103789 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006470] [ENSMUST00000108154]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000006470
AA Change: Y1789H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000006470
Gene: ENSMUSG00000006307
AA Change: Y1789H

Domain	Start	End	E-Value	Type
AT_hook	18	30	2.82e2	SMART
low complexity region	66	106	N/A	INTRINSIC
low complexity region	110	122	N/A	INTRINSIC
AT_hook	149	159	2.4e2	SMART
AT_hook	218	230	1.95e2	SMART
low complexity region	249	263	N/A	INTRINSIC
low complexity region	272	302	N/A	INTRINSIC
coiled coil region	353	413	N/A	INTRINSIC
AT_hook	476	488	5.47e-1	SMART
low complexity region	501	517	N/A	INTRINSIC
low complexity region	578	606	N/A	INTRINSIC
low complexity region	621	657	N/A	INTRINSIC
low complexity region	673	700	N/A	INTRINSIC
low complexity region	715	728	N/A	INTRINSIC
low complexity region	738	777	N/A	INTRINSIC
low complexity region	910	922	N/A	INTRINSIC
Pfam:zf-CXXC	963	1010	7.2e-15	PFAM
low complexity region	1039	1061	N/A	INTRINSIC
low complexity region	1103	1115	N/A	INTRINSIC
PHD	1209	1256	1.25e-5	SMART
PHD	1257	1307	5.4e-10	SMART
PHD	1343	1400	1.27e-6	SMART
low complexity region	1415	1427	N/A	INTRINSIC
PHD	1646	1692	3.82e-1	SMART
FYRN	1745	1788	3.25e-19	SMART
low complexity region	1881	1899	N/A	INTRINSIC
low complexity region	1912	1942	N/A	INTRINSIC
low complexity region	1961	1978	N/A	INTRINSIC
low complexity region	1991	2003	N/A	INTRINSIC
low complexity region	2013	2026	N/A	INTRINSIC
low complexity region	2048	2061	N/A	INTRINSIC
low complexity region	2087	2105	N/A	INTRINSIC
low complexity region	2127	2138	N/A	INTRINSIC
low complexity region	2215	2235	N/A	INTRINSIC
low complexity region	2239	2270	N/A	INTRINSIC
low complexity region	2396	2406	N/A	INTRINSIC
FYRC	2419	2504	4.83e-36	SMART
SET	2581	2703	1.67e-42	SMART
PostSET	2705	2721	4.65e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000108154
AA Change: Y1789H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000103789
Gene: ENSMUSG00000006307
AA Change: Y1789H

Domain	Start	End	E-Value	Type
AT_hook	18	30	2.82e2	SMART
low complexity region	66	106	N/A	INTRINSIC
low complexity region	110	122	N/A	INTRINSIC
AT_hook	149	159	2.4e2	SMART
AT_hook	218	230	1.95e2	SMART
low complexity region	249	263	N/A	INTRINSIC
low complexity region	272	302	N/A	INTRINSIC
coiled coil region	353	413	N/A	INTRINSIC
AT_hook	476	488	5.47e-1	SMART
low complexity region	501	517	N/A	INTRINSIC
low complexity region	578	606	N/A	INTRINSIC
low complexity region	621	657	N/A	INTRINSIC
low complexity region	673	700	N/A	INTRINSIC
low complexity region	715	728	N/A	INTRINSIC
low complexity region	738	777	N/A	INTRINSIC
low complexity region	910	922	N/A	INTRINSIC
Pfam:zf-CXXC	963	1010	1e-14	PFAM
low complexity region	1039	1061	N/A	INTRINSIC
low complexity region	1103	1115	N/A	INTRINSIC
PHD	1209	1256	1.25e-5	SMART
PHD	1257	1307	5.4e-10	SMART
PHD	1343	1400	1.27e-6	SMART
low complexity region	1415	1427	N/A	INTRINSIC
PHD	1646	1692	3.82e-1	SMART
FYRN	1745	1788	3.25e-19	SMART
low complexity region	1872	1890	N/A	INTRINSIC
low complexity region	1903	1933	N/A	INTRINSIC
low complexity region	1952	1969	N/A	INTRINSIC
low complexity region	1982	1994	N/A	INTRINSIC
low complexity region	2004	2017	N/A	INTRINSIC
low complexity region	2039	2052	N/A	INTRINSIC
low complexity region	2078	2096	N/A	INTRINSIC
low complexity region	2118	2129	N/A	INTRINSIC
low complexity region	2206	2226	N/A	INTRINSIC
low complexity region	2230	2261	N/A	INTRINSIC
low complexity region	2383	2398	N/A	INTRINSIC
FYRC	2411	2496	4.83e-36	SMART
SET	2573	2695	1.67e-42	SMART
PostSET	2697	2713	4.65e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125836

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128456

Predicted Effect

unknown
Transcript: ENSMUST00000131002
AA Change: Y1080H

SMART Domains

Protein: ENSMUSP00000118486
Gene: ENSMUSG00000006307
AA Change: Y1080H

Domain	Start	End	E-Value	Type
low complexity region	7	20	N/A	INTRINSIC
low complexity region	30	69	N/A	INTRINSIC
low complexity region	202	214	N/A	INTRINSIC
Pfam:zf-CXXC	255	302	5.2e-15	PFAM
low complexity region	331	353	N/A	INTRINSIC
low complexity region	395	407	N/A	INTRINSIC
PHD	501	548	1.25e-5	SMART
PHD	549	599	5.4e-10	SMART
PHD	635	692	1.27e-6	SMART
low complexity region	707	719	N/A	INTRINSIC
PHD	938	984	3.82e-1	SMART
FYRN	1037	1080	3.25e-19	SMART
low complexity region	1173	1191	N/A	INTRINSIC
low complexity region	1204	1234	N/A	INTRINSIC
low complexity region	1253	1270	N/A	INTRINSIC
low complexity region	1283	1295	N/A	INTRINSIC
low complexity region	1305	1318	N/A	INTRINSIC
low complexity region	1340	1353	N/A	INTRINSIC
low complexity region	1379	1397	N/A	INTRINSIC
low complexity region	1419	1430	N/A	INTRINSIC
low complexity region	1507	1527	N/A	INTRINSIC
low complexity region	1531	1562	N/A	INTRINSIC
low complexity region	1684	1699	N/A	INTRINSIC
FYRC	1712	1797	4.83e-36	SMART
SET	1874	1996	1.67e-42	SMART
PostSET	1998	2014	4.65e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152931

Meta Mutation Damage Score

0.0883

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.0%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains multiple domains including a CXXC zinc finger, three PHD zinc fingers, two FY-rich domains, and a SET (suppressor of variegation, enhancer of zeste, and trithorax) domain. The SET domain is a conserved C-terminal domain that characterizes proteins of the MLL (mixed-lineage leukemia) family. This gene is ubiquitously expressed in adult tissues. It is also amplified in solid tumor cell lines, and may be involved in human cancer. Two alternatively spliced transcript variants encoding distinct isoforms have been reported for this gene, however, the full length nature of the shorter transcript is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene leads to embryonic growth retardation, abnormal somite development, neural tube defects, increased apoptosis, and complete embryonic lethality. Homozygotes for a hypomorphic allele show embryonic growth arrest, altered DNA methylation, and reduced female fertility. [provided by MGI curators]

Allele List at MGI

All alleles(8) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(4)

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	T	C	7: 120,283,089	L1158P	probably damaging	Het
Acnat1	A	T	4: 49,451,077	N11K	possibly damaging	Het
Ammecr1l	T	A	18: 31,776,003	I217N	possibly damaging	Het
Ankrd11	G	A	8: 122,908,734	R54*	probably null	Het
Ccdc178	C	T	18: 22,131,414		probably null	Het
Ccdc36	G	T	9: 108,413,006	T133N	possibly damaging	Het
Clcn7	T	C	17: 25,153,140	S425P	probably benign	Het
Cnmd	A	G	14: 79,656,605	V114A	probably damaging	Het
Col13a1	T	C	10: 61,851,162	T651A	unknown	Het
Col1a2	G	A	6: 4,518,822		probably benign	Het
Cyp3a25	T	C	5: 145,986,968		probably null	Het
Dmrta1	A	T	4: 89,691,616	D271V	probably benign	Het
Efcab3	T	A	11: 105,072,318		probably null	Het
Exo5	T	C	4: 120,921,997	I224V	probably damaging	Het
Fam162b	C	A	10: 51,587,218	A118S	probably damaging	Het
Glb1	A	G	9: 114,454,257	T406A	possibly damaging	Het
Grk3	T	C	5: 112,914,983	N666S	probably benign	Het
Hars2	T	C	18: 36,789,523	F370L	possibly damaging	Het
Ighv8-11	T	G	12: 115,567,603		probably benign	Het
Inpp4b	A	T	8: 81,997,339	D500V	probably benign	Het
Itgb4	A	G	11: 116,006,563	D1534G	possibly damaging	Het
Kcnk2	G	C	1: 189,340,017	T38S	possibly damaging	Het
Kif16b	C	T	2: 142,756,122	V527I	probably benign	Het
Lpl	A	C	8: 68,901,243	D412A	possibly damaging	Het
Lrrc27	T	G	7: 139,223,613	L151R	probably damaging	Het
Muc3	T	C	5: 137,154,041		probably benign	Het
Nup205	T	A	6: 35,208,134	Y829*	probably null	Het
Obscn	T	C	11: 59,131,646	R758G	possibly damaging	Het
Olfm4	A	G	14: 80,021,752	Y447C	probably damaging	Het
Olfr1308	T	C	2: 111,960,149	Y308C	probably benign	Het
Pcdhb6	T	C	18: 37,335,169	V381A	probably benign	Het
Prmt2	C	T	10: 76,225,415	W79*	probably null	Het
Skiv2l	T	C	17: 34,840,385	M1029V	probably benign	Het
Stil	A	G	4: 115,016,286	R369G	probably null	Het
Ttc41	T	C	10: 86,724,374	I387T	probably benign	Het
Tubgcp6	A	G	15: 89,102,984	L1262P	probably benign	Het
Vmn2r112	T	A	17: 22,603,115	V258E	probably damaging	Het
Zfp804b	T	C	5: 6,769,445	H1206R	probably damaging	Het

Other mutations in Kmt2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00580:Kmt2b	APN	7	30586513	unclassified	probably benign
IGL00821:Kmt2b	APN	7	30570613	missense	probably damaging	1.00
IGL00985:Kmt2b	APN	7	30579927	missense	probably damaging	1.00
IGL01092:Kmt2b	APN	7	30580507	missense	probably damaging	1.00
IGL01933:Kmt2b	APN	7	30569514	critical splice donor site	probably null
IGL01949:Kmt2b	APN	7	30577161	splice site	probably null
IGL02253:Kmt2b	APN	7	30581727	missense	probably damaging	1.00
IGL02455:Kmt2b	APN	7	30578878	critical splice donor site	probably null
IGL02493:Kmt2b	APN	7	30569511	unclassified	probably benign
IGL02504:Kmt2b	APN	7	30586543	unclassified	probably benign
IGL02532:Kmt2b	APN	7	30586889	unclassified	probably benign
IGL02698:Kmt2b	APN	7	30578693	splice site	probably benign
IGL02717:Kmt2b	APN	7	30583444	missense	probably damaging	1.00
IGL02826:Kmt2b	APN	7	30577144	missense	probably damaging	1.00
IGL02966:Kmt2b	APN	7	30575462	missense	probably benign	0.02
IGL03386:Kmt2b	APN	7	30573971	missense	possibly damaging	0.94
Dean	UTSW	7	30569410	missense	possibly damaging	0.83
provost	UTSW	7	30582208	missense	probably damaging	1.00
tenure	UTSW	7	30569175	missense	probably damaging	1.00
3-1:Kmt2b	UTSW	7	30569615	nonsense	probably null
FR4304:Kmt2b	UTSW	7	30586363	unclassified	probably benign
FR4340:Kmt2b	UTSW	7	30586363	unclassified	probably benign
FR4340:Kmt2b	UTSW	7	30586369	unclassified	probably benign
FR4340:Kmt2b	UTSW	7	30586375	unclassified	probably benign
FR4342:Kmt2b	UTSW	7	30586375	unclassified	probably benign
FR4449:Kmt2b	UTSW	7	30586361	unclassified	probably benign
FR4449:Kmt2b	UTSW	7	30586366	unclassified	probably benign
FR4449:Kmt2b	UTSW	7	30586369	unclassified	probably benign
FR4548:Kmt2b	UTSW	7	30586380	unclassified	probably benign
FR4589:Kmt2b	UTSW	7	30586361	unclassified	probably benign
FR4589:Kmt2b	UTSW	7	30586364	nonsense	probably null
FR4589:Kmt2b	UTSW	7	30586381	unclassified	probably benign
FR4737:Kmt2b	UTSW	7	30586366	unclassified	probably benign
FR4737:Kmt2b	UTSW	7	30586367	unclassified	probably benign
FR4737:Kmt2b	UTSW	7	30586370	unclassified	probably benign
FR4737:Kmt2b	UTSW	7	30586378	unclassified	probably benign
FR4976:Kmt2b	UTSW	7	30586360	unclassified	probably benign
FR4976:Kmt2b	UTSW	7	30586362	unclassified	probably benign
FR4976:Kmt2b	UTSW	7	30586364	nonsense	probably null
FR4976:Kmt2b	UTSW	7	30586366	unclassified	probably benign
FR4976:Kmt2b	UTSW	7	30586373	unclassified	probably benign
PIT4403001:Kmt2b	UTSW	7	30585689	missense	probably damaging	1.00
PIT4802001:Kmt2b	UTSW	7	30579571	missense	probably damaging	0.99
R0057:Kmt2b	UTSW	7	30576792	splice site	probably benign
R0131:Kmt2b	UTSW	7	30583921	missense	probably damaging	0.99
R0241:Kmt2b	UTSW	7	30577069	missense	probably damaging	1.00
R0241:Kmt2b	UTSW	7	30577069	missense	probably damaging	1.00
R0377:Kmt2b	UTSW	7	30574193	missense	probably damaging	1.00
R0396:Kmt2b	UTSW	7	30576755	missense	probably damaging	1.00
R1241:Kmt2b	UTSW	7	30574940	missense	probably damaging	0.98
R1252:Kmt2b	UTSW	7	30580487	missense	probably damaging	0.99
R1418:Kmt2b	UTSW	7	30576960	splice site	probably benign
R1599:Kmt2b	UTSW	7	30570575	missense	probably damaging	1.00
R1632:Kmt2b	UTSW	7	30583962	missense	probably damaging	1.00
R1745:Kmt2b	UTSW	7	30585850	missense	possibly damaging	0.90
R1867:Kmt2b	UTSW	7	30574658	missense	possibly damaging	0.71
R1955:Kmt2b	UTSW	7	30575351	missense	possibly damaging	0.90
R2040:Kmt2b	UTSW	7	30569420	missense	probably damaging	1.00
R2113:Kmt2b	UTSW	7	30583387	missense	probably damaging	1.00
R2216:Kmt2b	UTSW	7	30574065	missense	probably benign	0.25
R2518:Kmt2b	UTSW	7	30576068	missense	probably benign	0.10
R3436:Kmt2b	UTSW	7	30576692	missense	probably damaging	1.00
R4248:Kmt2b	UTSW	7	30574064	missense	probably benign	0.25
R4259:Kmt2b	UTSW	7	30581081	missense	probably damaging	0.99
R4290:Kmt2b	UTSW	7	30581836	critical splice donor site	probably null
R4388:Kmt2b	UTSW	7	30588590	unclassified	probably benign
R4542:Kmt2b	UTSW	7	30580259	missense	probably damaging	0.99
R4649:Kmt2b	UTSW	7	30586358	unclassified	probably benign
R4722:Kmt2b	UTSW	7	30583202	missense	probably damaging	1.00
R4891:Kmt2b	UTSW	7	30576761	nonsense	probably null
R4916:Kmt2b	UTSW	7	30578517	missense	probably damaging	0.99
R5104:Kmt2b	UTSW	7	30569840	missense	probably damaging	1.00
R5254:Kmt2b	UTSW	7	30569175	missense	probably damaging	1.00
R5262:Kmt2b	UTSW	7	30569794	missense	probably damaging	1.00
R5307:Kmt2b	UTSW	7	30581673	missense	possibly damaging	0.91
R5526:Kmt2b	UTSW	7	30580444	missense	probably damaging	1.00
R5609:Kmt2b	UTSW	7	30577145	missense	probably damaging	0.99
R6150:Kmt2b	UTSW	7	30588477	unclassified	probably benign
R6727:Kmt2b	UTSW	7	30584559	missense	probably damaging	0.98
R6824:Kmt2b	UTSW	7	30586276	unclassified	probably benign
R7048:Kmt2b	UTSW	7	30569306	missense	probably damaging	0.99
R7155:Kmt2b	UTSW	7	30579963	missense	probably damaging	0.99
R7307:Kmt2b	UTSW	7	30580471	missense	probably damaging	0.99
R7388:Kmt2b	UTSW	7	30581960	missense	probably damaging	1.00
R7555:Kmt2b	UTSW	7	30569410	missense	possibly damaging	0.83
R7569:Kmt2b	UTSW	7	30569553	missense	possibly damaging	0.54
R7616:Kmt2b	UTSW	7	30582208	missense	probably damaging	1.00
R7669:Kmt2b	UTSW	7	30583231	missense	possibly damaging	0.84
R7881:Kmt2b	UTSW	7	30579783	missense	probably damaging	1.00
R7999:Kmt2b	UTSW	7	30576774	missense	probably damaging	1.00
R8003:Kmt2b	UTSW	7	30569377	missense	probably damaging	0.98
R8189:Kmt2b	UTSW	7	30569331	missense	probably damaging	0.98
R8291:Kmt2b	UTSW	7	30585469	missense	probably damaging	1.00
R8314:Kmt2b	UTSW	7	30578922	missense	probably damaging	0.99
R8802:Kmt2b	UTSW	7	30584071	missense	probably damaging	1.00
R8954:Kmt2b	UTSW	7	30574215	missense	probably damaging	1.00
R9046:Kmt2b	UTSW	7	30586054	missense	probably benign	0.00
R9225:Kmt2b	UTSW	7	30586747	missense	unknown
R9258:Kmt2b	UTSW	7	30582468	missense	probably null	0.99
R9414:Kmt2b	UTSW	7	30582882	missense	probably damaging	0.99
R9468:Kmt2b	UTSW	7	30585088	missense	probably damaging	0.98
R9508:Kmt2b	UTSW	7	30569834	missense	probably damaging	0.99
R9642:Kmt2b	UTSW	7	30583915	critical splice donor site	probably null
R9667:Kmt2b	UTSW	7	30588359	missense	unknown
R9709:Kmt2b	UTSW	7	30579803	missense	probably damaging	0.98
RF001:Kmt2b	UTSW	7	30586382	unclassified	probably benign
RF006:Kmt2b	UTSW	7	30586377	unclassified	probably benign
RF020:Kmt2b	UTSW	7	30586382	unclassified	probably benign
RF021:Kmt2b	UTSW	7	30586357	unclassified	probably benign
RF030:Kmt2b	UTSW	7	30586377	unclassified	probably benign
RF035:Kmt2b	UTSW	7	30586357	unclassified	probably benign
X0067:Kmt2b	UTSW	7	30579573	missense	probably damaging	0.99
Z1088:Kmt2b	UTSW	7	30585251	missense	probably benign	0.28
Z1176:Kmt2b	UTSW	7	30577370	missense	probably damaging	1.00
Z1177:Kmt2b	UTSW	7	30575024	missense	probably benign	0.08
Z1177:Kmt2b	UTSW	7	30584163	missense	probably damaging	0.98
Z1177:Kmt2b	UTSW	7	30586416	missense	unknown
Z1186:Kmt2b	UTSW	7	30574979	missense	probably benign
Z1186:Kmt2b	UTSW	7	30585307	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CCATTGTTTCTGTCATTTCGAGAG -3'
(R):5'- CATTGGCTACCAGTGAGCAC -3'

Sequencing Primer
(F):5'- CCTGAAGTTTCTCAACACATGGAG -3'
(R):5'- TACCAGTGAGCACCCCAGG -3'

Posted On

2014-11-11