Incidental Mutation 'R0302:Epsti1'
ID24869
Institutional Source Beutler Lab
Gene Symbol Epsti1
Ensembl Gene ENSMUSG00000022014
Gene Nameepithelial stromal interaction 1 (breast)
Synonyms5033415K03Rik, 2310046K10Rik, BRESI1
MMRRC Submission 038514-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R0302 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location77904239-78002657 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 77939926 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 182 (H182L)
Ref Sequence ENSEMBL: ENSMUSP00000130138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022591] [ENSMUST00000169978] [ENSMUST00000227903]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022591
AA Change: H182L

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022591
Gene: ENSMUSG00000022014
AA Change: H182L

DomainStartEndE-ValueType
coiled coil region 111 180 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169978
AA Change: H182L

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000130138
Gene: ENSMUSG00000022014
AA Change: H182L

DomainStartEndE-ValueType
coiled coil region 111 180 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000227903
AA Change: H182L

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.0819 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.1%
  • 20x: 89.5%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has been shown to promote tumor invasion and metastasis in some invasive cancer cells when overexpressed. Expression of this gene has been shown to be upregulated by direct binding of the Kruppel like factor 8 protein to promoter sequences. The translated protein interacts with the amino terminal region of the valosin containing protein gene product, resulting in the nuclear translocation of the nuclear factor kappa B subunit 1 gene product, and activation of target genes. Overexpression of this gene has been observed in some breast cancers and in some individuals with systemic lupus erythematosus (SLE). [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl2 T C 4: 126,317,392 E244G probably benign Het
Aldh1l2 G A 10: 83,520,365 P54S probably damaging Het
Ankdd1a G A 9: 65,509,642 probably benign Het
Ankra2 T A 13: 98,271,692 S216R probably damaging Het
Asah2 A T 19: 32,052,956 N105K probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Cacna1s A G 1: 136,100,604 Y893C probably benign Het
Capza2 G A 6: 17,648,524 R15H probably benign Het
Cbfa2t2 T C 2: 154,534,876 probably benign Het
Ccdc96 A T 5: 36,486,101 T484S possibly damaging Het
Cckar GCTTAGCCTCTTCT GCT 5: 53,700,299 probably null Het
Ccl4 T A 11: 83,663,454 probably benign Het
Cpt1b A G 15: 89,417,870 Y702H probably benign Het
Cr1l G A 1: 195,117,793 T153I probably damaging Het
Cyth2 C A 7: 45,810,585 E57* probably null Het
Daxx T A 17: 33,913,620 S575T probably damaging Het
Depdc5 T C 5: 32,904,546 probably benign Het
Dnah12 A G 14: 26,799,999 D1923G probably damaging Het
Dnah7b A G 1: 46,123,777 T428A probably benign Het
Dnm2 G T 9: 21,500,343 A619S probably benign Het
Enpp2 T C 15: 54,860,061 T639A probably benign Het
Exoc3l C T 8: 105,293,543 R250Q probably benign Het
Ggn G T 7: 29,171,240 probably null Het
Il1rap A G 16: 26,692,794 N196S probably benign Het
Ints6 T C 14: 62,709,512 T335A probably damaging Het
Itga1 G A 13: 115,012,318 probably benign Het
Kifc3 G T 8: 95,103,470 Q557K possibly damaging Het
Krt23 A G 11: 99,478,201 I422T probably benign Het
Lcn2 A G 2: 32,384,889 probably benign Het
Lonp2 A G 8: 86,637,991 T326A possibly damaging Het
Lrpprc T C 17: 84,740,078 I909V possibly damaging Het
Lrrc14 G T 15: 76,714,352 R396L probably benign Het
Lypd6 T G 2: 50,165,667 probably benign Het
Man2b1 A G 8: 85,093,016 N610S probably damaging Het
Map2 A T 1: 66,414,828 N959I probably benign Het
Mctp2 C T 7: 72,090,264 V793I possibly damaging Het
Med25 A C 7: 44,880,558 probably benign Het
Mfsd6 T C 1: 52,709,457 Y83C probably damaging Het
Mtbp A T 15: 55,625,424 M499L probably damaging Het
Mtmr10 A T 7: 64,297,497 K53N probably damaging Het
Nfat5 T C 8: 107,358,701 I542T probably damaging Het
Nr1h3 A G 2: 91,192,013 M90T probably damaging Het
Nsmce4a A G 7: 130,545,893 probably benign Het
Olfr1168 T A 2: 88,185,510 I211N possibly damaging Het
Oprl1 G A 2: 181,719,228 C318Y probably benign Het
Pbx3 A T 2: 34,224,560 S46T probably benign Het
Pign A T 1: 105,589,093 F575I possibly damaging Het
Ptpn13 G T 5: 103,565,225 S1738I probably benign Het
Rnf126 G T 10: 79,759,223 P269Q probably damaging Het
Ryr3 G A 2: 112,647,123 probably benign Het
Slc2a7 C T 4: 150,149,521 A31V probably damaging Het
Slc6a12 A G 6: 121,363,259 D487G probably damaging Het
Son G T 16: 91,656,144 G593V probably damaging Het
Spata31d1a T C 13: 59,703,150 N388S probably benign Het
Spg11 A T 2: 122,092,187 M927K possibly damaging Het
Taf13 A G 3: 108,571,722 M1V probably null Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Trio A G 15: 27,902,517 F286S probably damaging Het
Trpm2 A C 10: 77,943,990 probably benign Het
Ttc7b T C 12: 100,387,179 M390V possibly damaging Het
Vmn1r184 A T 7: 26,267,543 Q238L probably damaging Het
Zfp236 T C 18: 82,658,088 E368G probably damaging Het
Zfr2 G T 10: 81,251,336 probably benign Het
Other mutations in Epsti1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01787:Epsti1 APN 14 77972612 critical splice donor site probably null
IGL02749:Epsti1 APN 14 77939923 missense probably damaging 1.00
IGL03031:Epsti1 APN 14 77974581 missense probably benign 0.00
R0605:Epsti1 UTSW 14 77927237 splice site probably benign
R0743:Epsti1 UTSW 14 77931275 missense probably damaging 1.00
R0884:Epsti1 UTSW 14 77931275 missense probably damaging 1.00
R1986:Epsti1 UTSW 14 77932233 critical splice donor site probably null
R3162:Epsti1 UTSW 14 77974513 splice site probably benign
R5118:Epsti1 UTSW 14 77986682 splice site probably null
R5296:Epsti1 UTSW 14 77904650 missense probably benign 0.03
R5392:Epsti1 UTSW 14 77986744 missense probably benign 0.00
R5664:Epsti1 UTSW 14 77963664 missense possibly damaging 0.73
R5948:Epsti1 UTSW 14 77939890 missense probably damaging 1.00
R6402:Epsti1 UTSW 14 77939878 missense probably damaging 0.98
R7494:Epsti1 UTSW 14 77928754 missense probably benign 0.10
R7520:Epsti1 UTSW 14 77963443 splice site probably null
R7671:Epsti1 UTSW 14 77904490 missense probably damaging 1.00
R8039:Epsti1 UTSW 14 77931301 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCTCAGGATCTCTGTAGCCACTAGAAC -3'
(R):5'- ACAGTCAGCAGTACCCTGGAATCTAAC -3'

Sequencing Primer
(F):5'- TAGCCACTAGAACGGAGGATTTG -3'
(R):5'- GATGATTGTAAGCGACCTGATCTC -3'
Posted On2013-04-16