Incidental Mutation 'R2401:Ccdc36'
ID248695
Institutional Source Beutler Lab
Gene Symbol Ccdc36
Ensembl Gene ENSMUSG00000047220
Gene Namecoiled-coil domain containing 36
Synonyms
MMRRC Submission 040367-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R2401 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location108403611-108428484 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 108413006 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 133 (T133N)
Ref Sequence ENSEMBL: ENSMUSP00000075898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076592] [ENSMUST00000192995]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076592
AA Change: T133N

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000075898
Gene: ENSMUSG00000047220
AA Change: T133N

DomainStartEndE-ValueType
Pfam:DUF4700 19 572 4.7e-274 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192995
Meta Mutation Damage Score 0.0949 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 120,283,089 L1158P probably damaging Het
Acnat1 A T 4: 49,451,077 N11K possibly damaging Het
Ammecr1l T A 18: 31,776,003 I217N possibly damaging Het
Ankrd11 G A 8: 122,908,734 R54* probably null Het
Ccdc178 C T 18: 22,131,414 probably null Het
Clcn7 T C 17: 25,153,140 S425P probably benign Het
Cnmd A G 14: 79,656,605 V114A probably damaging Het
Col13a1 T C 10: 61,851,162 T651A unknown Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyp3a25 T C 5: 145,986,968 probably null Het
Dmrta1 A T 4: 89,691,616 D271V probably benign Het
Efcab3 T A 11: 105,072,318 probably null Het
Exo5 T C 4: 120,921,997 I224V probably damaging Het
Fam162b C A 10: 51,587,218 A118S probably damaging Het
Glb1 A G 9: 114,454,257 T406A possibly damaging Het
Grk3 T C 5: 112,914,983 N666S probably benign Het
Hars2 T C 18: 36,789,523 F370L possibly damaging Het
Ighv8-11 T G 12: 115,567,603 probably benign Het
Inpp4b A T 8: 81,997,339 D500V probably benign Het
Itgb4 A G 11: 116,006,563 D1534G possibly damaging Het
Kcnk2 G C 1: 189,340,017 T38S possibly damaging Het
Kif16b C T 2: 142,756,122 V527I probably benign Het
Kmt2b A G 7: 30,576,708 Y1789H probably damaging Het
Lpl A C 8: 68,901,243 D412A possibly damaging Het
Lrrc27 T G 7: 139,223,613 L151R probably damaging Het
Muc3 T C 5: 137,154,041 probably benign Het
Nup205 T A 6: 35,208,134 Y829* probably null Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfm4 A G 14: 80,021,752 Y447C probably damaging Het
Olfr1308 T C 2: 111,960,149 Y308C probably benign Het
Pcdhb6 T C 18: 37,335,169 V381A probably benign Het
Prmt2 C T 10: 76,225,415 W79* probably null Het
Skiv2l T C 17: 34,840,385 M1029V probably benign Het
Stil A G 4: 115,016,286 R369G probably null Het
Ttc41 T C 10: 86,724,374 I387T probably benign Het
Tubgcp6 A G 15: 89,102,984 L1262P probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Zfp804b T C 5: 6,769,445 H1206R probably damaging Het
Other mutations in Ccdc36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01956:Ccdc36 APN 9 108417319 splice site probably benign
IGL02138:Ccdc36 APN 9 108406621 missense probably benign 0.00
IGL02305:Ccdc36 APN 9 108405832 missense possibly damaging 0.82
IGL02456:Ccdc36 APN 9 108406621 missense probably benign 0.00
IGL02936:Ccdc36 APN 9 108412503 missense possibly damaging 0.69
IGL03150:Ccdc36 APN 9 108404956 missense probably damaging 0.98
IGL03163:Ccdc36 APN 9 108404933 missense probably benign 0.00
IGL03280:Ccdc36 APN 9 108404900 missense possibly damaging 0.92
R0139:Ccdc36 UTSW 9 108412496 missense probably damaging 1.00
R0276:Ccdc36 UTSW 9 108428440 missense possibly damaging 0.84
R0744:Ccdc36 UTSW 9 108404801 missense probably benign
R0836:Ccdc36 UTSW 9 108404801 missense probably benign
R1792:Ccdc36 UTSW 9 108404912 missense possibly damaging 0.84
R1918:Ccdc36 UTSW 9 108412985 missense probably benign 0.16
R2284:Ccdc36 UTSW 9 108421473 missense probably damaging 1.00
R4731:Ccdc36 UTSW 9 108405385 missense probably benign 0.00
R4819:Ccdc36 UTSW 9 108406678 missense probably benign 0.10
R4950:Ccdc36 UTSW 9 108421510 missense probably damaging 1.00
R4968:Ccdc36 UTSW 9 108412514 missense probably benign 0.11
R7131:Ccdc36 UTSW 9 108417420 missense probably benign 0.01
R7201:Ccdc36 UTSW 9 108404775 missense probably damaging 0.98
R7950:Ccdc36 UTSW 9 108405671 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTGCCCTCCAAGGACACTG -3'
(R):5'- TCACAAATGTCCTTAACTCCGGTTC -3'

Sequencing Primer
(F):5'- ACGGTTCGTGGACATACATAC -3'
(R):5'- ACCAGGCCTGCATATGGTAC -3'
Posted On2014-11-11