Mutagenetix > Incidental Mutation

Incidental Mutation 'R2401:Glb1'

248696

Institutional Source

Beutler Lab

Gene Symbol

Glb1

Ensembl Gene

ENSMUSG00000045594

Gene Name

galactosidase, beta 1

Synonyms

C130097A14Rik, Bgs, Bgl-t, Bgl, Bgl-e, Bgt, Bge, Bgl-s

MMRRC Submission

040367-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2401 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

114401076-114474898 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 114454257 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 406 (T406A)

Ref Sequence

ENSEMBL: ENSMUSP00000055803 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063042] [ENSMUST00000217583]

AlphaFold

P23780

Predicted Effect

possibly damaging
Transcript: ENSMUST00000063042
AA Change: T406A

PolyPhen 2 Score 0.811 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000055803
Gene: ENSMUSG00000045594
AA Change: T406A

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Glyco_hydro_35	41	358	2.5e-129	PFAM
Pfam:Glyco_hydro_42	56	216	9.4e-15	PFAM
Pfam:BetaGal_dom4_5	531	623	4.3e-10	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000217583

Meta Mutation Damage Score

0.2609

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.0%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: This gene encodes a preproprotein that is proteolytically cleaved to yield a signal peptide and a proproptein that is subsequently processed to generate the active mature peptide. The encoded protein is a lysosomal enzyme that catalyzes the hydrolysis of terminal beta-D-galactose residues in various substrates like lactose, ganglioside GM1 and other glycoproteins. Mutations in the human gene are associated with GM1-gangliosidosis and Morquio B syndrome. Disruption of the mouse gene mirrors the symptoms of human gangliosidosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit progressive spastic diplegia, emaciation, and accumulation of ganglioside GM1 and asialo GM1 in brain tissue. Mutants die at 7-10 months of age. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	T	C	7: 120,283,089	L1158P	probably damaging	Het
Acnat1	A	T	4: 49,451,077	N11K	possibly damaging	Het
Ammecr1l	T	A	18: 31,776,003	I217N	possibly damaging	Het
Ankrd11	G	A	8: 122,908,734	R54*	probably null	Het
Ccdc178	C	T	18: 22,131,414		probably null	Het
Ccdc36	G	T	9: 108,413,006	T133N	possibly damaging	Het
Clcn7	T	C	17: 25,153,140	S425P	probably benign	Het
Cnmd	A	G	14: 79,656,605	V114A	probably damaging	Het
Col13a1	T	C	10: 61,851,162	T651A	unknown	Het
Col1a2	G	A	6: 4,518,822		probably benign	Het
Cyp3a25	T	C	5: 145,986,968		probably null	Het
Dmrta1	A	T	4: 89,691,616	D271V	probably benign	Het
Efcab3	T	A	11: 105,072,318		probably null	Het
Exo5	T	C	4: 120,921,997	I224V	probably damaging	Het
Fam162b	C	A	10: 51,587,218	A118S	probably damaging	Het
Grk3	T	C	5: 112,914,983	N666S	probably benign	Het
Hars2	T	C	18: 36,789,523	F370L	possibly damaging	Het
Ighv8-11	T	G	12: 115,567,603		probably benign	Het
Inpp4b	A	T	8: 81,997,339	D500V	probably benign	Het
Itgb4	A	G	11: 116,006,563	D1534G	possibly damaging	Het
Kcnk2	G	C	1: 189,340,017	T38S	possibly damaging	Het
Kif16b	C	T	2: 142,756,122	V527I	probably benign	Het
Kmt2b	A	G	7: 30,576,708	Y1789H	probably damaging	Het
Lpl	A	C	8: 68,901,243	D412A	possibly damaging	Het
Lrrc27	T	G	7: 139,223,613	L151R	probably damaging	Het
Muc3	T	C	5: 137,154,041		probably benign	Het
Nup205	T	A	6: 35,208,134	Y829*	probably null	Het
Obscn	T	C	11: 59,131,646	R758G	possibly damaging	Het
Olfm4	A	G	14: 80,021,752	Y447C	probably damaging	Het
Olfr1308	T	C	2: 111,960,149	Y308C	probably benign	Het
Pcdhb6	T	C	18: 37,335,169	V381A	probably benign	Het
Prmt2	C	T	10: 76,225,415	W79*	probably null	Het
Skiv2l	T	C	17: 34,840,385	M1029V	probably benign	Het
Stil	A	G	4: 115,016,286	R369G	probably null	Het
Ttc41	T	C	10: 86,724,374	I387T	probably benign	Het
Tubgcp6	A	G	15: 89,102,984	L1262P	probably benign	Het
Vmn2r112	T	A	17: 22,603,115	V258E	probably damaging	Het
Zfp804b	T	C	5: 6,769,445	H1206R	probably damaging	Het

Other mutations in Glb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01448:Glb1	APN	9	114450677	splice site	probably benign
IGL01649:Glb1	APN	9	114423948	missense	probably damaging	1.00
IGL01720:Glb1	APN	9	114420505	critical splice donor site	probably null
IGL02199:Glb1	APN	9	114473947	missense	probably benign	0.06
IGL02613:Glb1	APN	9	114464062	missense	possibly damaging	0.91
IGL03392:Glb1	APN	9	114430321	missense	probably damaging	1.00
R0463:Glb1	UTSW	9	114421744	frame shift	probably null
R0518:Glb1	UTSW	9	114421744	frame shift	probably null
R0519:Glb1	UTSW	9	114421744	frame shift	probably null
R0520:Glb1	UTSW	9	114421744	frame shift	probably null
R1387:Glb1	UTSW	9	114420363	missense	probably damaging	1.00
R1499:Glb1	UTSW	9	114417103	missense	probably benign	0.04
R1898:Glb1	UTSW	9	114424035	missense	probably damaging	1.00
R2143:Glb1	UTSW	9	114437824	missense	probably damaging	1.00
R2145:Glb1	UTSW	9	114464165	missense	probably benign	0.00
R2146:Glb1	UTSW	9	114450648	missense	probably damaging	1.00
R2148:Glb1	UTSW	9	114450648	missense	probably damaging	1.00
R2149:Glb1	UTSW	9	114450648	missense	probably damaging	1.00
R2150:Glb1	UTSW	9	114450648	missense	probably damaging	1.00
R2170:Glb1	UTSW	9	114473805	critical splice acceptor site	probably benign
R2259:Glb1	UTSW	9	114443032	nonsense	probably null
R3980:Glb1	UTSW	9	114417064	missense	probably damaging	0.97
R4488:Glb1	UTSW	9	114443114	missense	probably damaging	1.00
R4696:Glb1	UTSW	9	114464152	missense	probably benign
R5349:Glb1	UTSW	9	114434461	critical splice donor site	probably null
R6045:Glb1	UTSW	9	114437942	missense	probably damaging	1.00
R6448:Glb1	UTSW	9	114434431	missense	probably damaging	0.99
R7308:Glb1	UTSW	9	114473863	missense	probably damaging	0.98
R7327:Glb1	UTSW	9	114417058	missense	probably benign	0.00
R7492:Glb1	UTSW	9	114473949	missense	probably damaging	1.00
R8087:Glb1	UTSW	9	114430415	missense	probably damaging	1.00
R8181:Glb1	UTSW	9	114430361	missense	probably damaging	1.00
R9067:Glb1	UTSW	9	114473854	missense	probably damaging	0.99
R9187:Glb1	UTSW	9	114473923	missense	probably damaging	1.00
R9289:Glb1	UTSW	9	114420490	missense	probably damaging	1.00
R9315:Glb1	UTSW	9	114456480	missense	probably benign
R9777:Glb1	UTSW	9	114417016	missense	probably damaging	1.00
X0052:Glb1	UTSW	9	114473805	critical splice acceptor site	probably benign
Z1177:Glb1	UTSW	9	114420422	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGGAACTTGGACAGTTGAGAC -3'
(R):5'- AGAGCACAACAATGTTCTTCCC -3'

Sequencing Primer
(F):5'- GAACTTGGACAGTTGAGACTTCTCTC -3'
(R):5'- GGCCTCGAATACCATGTATCTGAG -3'

Posted On

2014-11-11