Mutagenetix > Incidental Mutation

Incidental Mutation 'R2401:Col13a1'

248698

Institutional Source

Beutler Lab

Gene Symbol

Col13a1

Ensembl Gene

ENSMUSG00000058806

Gene Name

collagen, type XIII, alpha 1

Synonyms

MMRRC Submission

040367-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2401 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

61838236-61979108 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 61851162 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 651 (T651A)

Ref Sequence

ENSEMBL: ENSMUSP00000101094 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105452] [ENSMUST00000105453] [ENSMUST00000105454]

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000051826

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000105451

Predicted Effect

unknown
Transcript: ENSMUST00000105452
AA Change: T621A

SMART Domains

Protein: ENSMUSP00000101092
Gene: ENSMUSG00000058806
AA Change: T621A

Domain	Start	End	E-Value	Type
low complexity region	41	59	N/A	INTRINSIC
low complexity region	113	132	N/A	INTRINSIC
Pfam:Collagen	154	214	1.6e-12	PFAM
Pfam:Collagen	255	319	1.8e-10	PFAM
Pfam:Collagen	283	338	7.8e-11	PFAM
Pfam:Collagen	313	376	6.8e-10	PFAM
Pfam:Collagen	377	436	3e-10	PFAM
Pfam:Collagen	458	517	4.3e-12	PFAM
Pfam:Collagen	498	559	7.7e-12	PFAM
Pfam:Collagen	557	616	1.6e-11	PFAM
Pfam:Collagen	587	666	9.8e-8	PFAM
Pfam:Collagen	635	704	4e-11	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000105453
AA Change: T587A

SMART Domains

Protein: ENSMUSP00000101093
Gene: ENSMUSG00000058806
AA Change: T587A

Domain	Start	End	E-Value	Type
internal_repeat_5	17	30	7.25e-5	PROSPERO
low complexity region	41	59	N/A	INTRINSIC
low complexity region	113	132	N/A	INTRINSIC
internal_repeat_5	140	153	7.25e-5	PROSPERO
Pfam:Collagen	154	214	1.5e-12	PFAM
Pfam:Collagen	235	296	1e-10	PFAM
internal_repeat_2	297	328	1.33e-8	PROSPERO
internal_repeat_1	297	332	1.43e-12	PROSPERO
Pfam:Collagen	355	414	2.8e-10	PFAM
Pfam:Collagen	436	495	4.6e-12	PFAM
Pfam:Collagen	477	551	3.6e-8	PFAM
Pfam:Collagen	536	606	5.1e-10	PFAM
Pfam:Collagen	574	670	1.6e-7	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000105454
AA Change: T651A

SMART Domains

Protein: ENSMUSP00000101094
Gene: ENSMUSG00000058806
AA Change: T651A

Domain	Start	End	E-Value	Type
low complexity region	41	59	N/A	INTRINSIC
Pfam:Collagen	112	161	6.7e-9	PFAM
Pfam:Collagen	164	223	1.5e-11	PFAM
Pfam:Collagen	264	328	6.7e-10	PFAM
Pfam:Collagen	292	347	2.8e-10	PFAM
Pfam:Collagen	322	385	2.3e-9	PFAM
Pfam:Collagen	386	445	1.1e-9	PFAM
Pfam:Collagen	467	526	1.6e-11	PFAM
Pfam:Collagen	507	582	4.8e-9	PFAM
Pfam:Collagen	564	630	5.4e-9	PFAM
low complexity region	671	695	N/A	INTRINSIC
internal_repeat_2	698	723	7.38e-7	PROSPERO

Predicted Effect

unknown
Transcript: ENSMUST00000145469
AA Change: T155A

SMART Domains

Protein: ENSMUSP00000117248
Gene: ENSMUSG00000058806
AA Change: T155A

Domain	Start	End	E-Value	Type
Pfam:Collagen	8	67	1.1e-12	PFAM
Pfam:Collagen	93	156	7.2e-12	PFAM
Pfam:Collagen	170	239	9.6e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153120

Meta Mutation Damage Score

0.0594

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.0%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of one of the nonfibrillar collagens. The function of this gene product is not known, however, it has been detected at low levels in all connective tissue-producing cells so it may serve a general function in connective tissues. Unlike most of the collagens, which are secreted into the extracellular matrix, collagen XIII contains a transmembrane domain and the protein has been localized to the plasma membrane. The transcripts for this gene undergo complex and extensive splicing involving at least eight exons. Like other collagens, collagen XIII is a trimer; it is not known whether this trimer is composed of one or more than one alpha chain isomer. A number of alternatively spliced transcript variants have been described, but the full length nature of some of them has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an allele lacking the transmembrane exhibit small muscle fibers and are susceptible to excerise-induced muscle damage and muscle inflammation. Mice homozygous for a knock-out allele exhibit tremors and abnormal neuromuscular junction morphology and endplate potential. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	T	C	7: 120,283,089	L1158P	probably damaging	Het
Acnat1	A	T	4: 49,451,077	N11K	possibly damaging	Het
Ammecr1l	T	A	18: 31,776,003	I217N	possibly damaging	Het
Ankrd11	G	A	8: 122,908,734	R54*	probably null	Het
Ccdc178	C	T	18: 22,131,414		probably null	Het
Ccdc36	G	T	9: 108,413,006	T133N	possibly damaging	Het
Clcn7	T	C	17: 25,153,140	S425P	probably benign	Het
Cnmd	A	G	14: 79,656,605	V114A	probably damaging	Het
Col1a2	G	A	6: 4,518,822		probably benign	Het
Cyp3a25	T	C	5: 145,986,968		probably null	Het
Dmrta1	A	T	4: 89,691,616	D271V	probably benign	Het
Efcab3	T	A	11: 105,072,318		probably null	Het
Exo5	T	C	4: 120,921,997	I224V	probably damaging	Het
Fam162b	C	A	10: 51,587,218	A118S	probably damaging	Het
Glb1	A	G	9: 114,454,257	T406A	possibly damaging	Het
Grk3	T	C	5: 112,914,983	N666S	probably benign	Het
Hars2	T	C	18: 36,789,523	F370L	possibly damaging	Het
Ighv8-11	T	G	12: 115,567,603		probably benign	Het
Inpp4b	A	T	8: 81,997,339	D500V	probably benign	Het
Itgb4	A	G	11: 116,006,563	D1534G	possibly damaging	Het
Kcnk2	G	C	1: 189,340,017	T38S	possibly damaging	Het
Kif16b	C	T	2: 142,756,122	V527I	probably benign	Het
Kmt2b	A	G	7: 30,576,708	Y1789H	probably damaging	Het
Lpl	A	C	8: 68,901,243	D412A	possibly damaging	Het
Lrrc27	T	G	7: 139,223,613	L151R	probably damaging	Het
Muc3	T	C	5: 137,154,041		probably benign	Het
Nup205	T	A	6: 35,208,134	Y829*	probably null	Het
Obscn	T	C	11: 59,131,646	R758G	possibly damaging	Het
Olfm4	A	G	14: 80,021,752	Y447C	probably damaging	Het
Olfr1308	T	C	2: 111,960,149	Y308C	probably benign	Het
Pcdhb6	T	C	18: 37,335,169	V381A	probably benign	Het
Prmt2	C	T	10: 76,225,415	W79*	probably null	Het
Skiv2l	T	C	17: 34,840,385	M1029V	probably benign	Het
Stil	A	G	4: 115,016,286	R369G	probably null	Het
Ttc41	T	C	10: 86,724,374	I387T	probably benign	Het
Tubgcp6	A	G	15: 89,102,984	L1262P	probably benign	Het
Vmn2r112	T	A	17: 22,603,115	V258E	probably damaging	Het
Zfp804b	T	C	5: 6,769,445	H1206R	probably damaging	Het

Other mutations in Col13a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00491:Col13a1	APN	10	61864005	critical splice acceptor site	probably null
IGL00936:Col13a1	APN	10	61876290	missense	probably damaging	0.99
IGL00963:Col13a1	APN	10	61838697	utr 3 prime	probably benign
IGL01801:Col13a1	APN	10	61843614	missense	probably damaging	1.00
IGL02247:Col13a1	APN	10	61961345	missense	probably damaging	1.00
IGL02296:Col13a1	APN	10	61862025	intron	probably benign
IGL02430:Col13a1	APN	10	61874751	missense	probably benign	0.26
IGL02884:Col13a1	APN	10	61905285	splice site	probably benign
IGL03036:Col13a1	APN	10	61893913	critical splice donor site	probably null
IGL03145:Col13a1	APN	10	61891261	missense	probably benign	0.07
IGL03392:Col13a1	APN	10	61885711	missense	possibly damaging	0.88
R0027:Col13a1	UTSW	10	61850161	missense	unknown
R0440:Col13a1	UTSW	10	61867483	missense	possibly damaging	0.85
R0518:Col13a1	UTSW	10	61862746	missense	unknown
R0521:Col13a1	UTSW	10	61862746	missense	unknown
R0631:Col13a1	UTSW	10	61887350	nonsense	probably null
R1311:Col13a1	UTSW	10	61864010	splice site	probably benign
R1350:Col13a1	UTSW	10	61894069	splice site	probably benign
R1572:Col13a1	UTSW	10	61866426	splice site	probably null
R2883:Col13a1	UTSW	10	61978356	missense	probably benign	0.23
R2906:Col13a1	UTSW	10	61860488	intron	probably benign
R2964:Col13a1	UTSW	10	61961331	missense	probably damaging	1.00
R2965:Col13a1	UTSW	10	61961331	missense	probably damaging	1.00
R3703:Col13a1	UTSW	10	61867829	critical splice donor site	probably null
R3704:Col13a1	UTSW	10	61867829	critical splice donor site	probably null
R3844:Col13a1	UTSW	10	61850209	missense	unknown
R3928:Col13a1	UTSW	10	61867525	unclassified	probably benign
R3939:Col13a1	UTSW	10	61863082	missense	unknown
R4327:Col13a1	UTSW	10	61863979	missense	unknown
R4328:Col13a1	UTSW	10	61863979	missense	unknown
R4329:Col13a1	UTSW	10	61863979	missense	unknown
R4585:Col13a1	UTSW	10	61887245	splice site	probably null
R4705:Col13a1	UTSW	10	61850165	missense	unknown
R4864:Col13a1	UTSW	10	61862660	missense	unknown
R5072:Col13a1	UTSW	10	61874018	splice site	silent
R5074:Col13a1	UTSW	10	61874018	splice site	silent
R5114:Col13a1	UTSW	10	61890101	missense	possibly damaging	0.82
R5625:Col13a1	UTSW	10	61843609	missense	unknown
R5664:Col13a1	UTSW	10	61851116	missense	probably damaging	1.00
R5799:Col13a1	UTSW	10	61849140	intron	probably benign
R8482:Col13a1	UTSW	10	61884698	missense	probably damaging	1.00
R8989:Col13a1	UTSW	10	61860471	missense	unknown
R9181:Col13a1	UTSW	10	61867833	missense	possibly damaging	0.66
R9183:Col13a1	UTSW	10	61863979	missense	unknown
R9215:Col13a1	UTSW	10	61850211	critical splice acceptor site	probably null
R9307:Col13a1	UTSW	10	61867469	missense	unknown
Z1177:Col13a1	UTSW	10	61905262	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAGCTTTTCCATCTCACCCAAG -3'
(R):5'- AAATGGACCATGGCCAAGGC -3'

Sequencing Primer
(F):5'- AAGCTTCTGTCTCCCCAGAGG -3'
(R):5'- GCAAATGGCCTCCTCGAATG -3'

Posted On

2014-11-11