Incidental Mutation 'R2401:Ttc41'
ID 248700
Institutional Source Beutler Lab
Gene Symbol Ttc41
Ensembl Gene ENSMUSG00000044937
Gene Name tetratricopeptide repeat domain 41
Synonyms Gnn, BC030307
MMRRC Submission 040367-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.115) question?
Stock # R2401 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 86705811-86776844 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 86724374 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 387 (I387T)
Ref Sequence ENSEMBL: ENSMUSP00000075059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061458] [ENSMUST00000075632] [ENSMUST00000217747] [ENSMUST00000219108]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000061458
AA Change: I387T

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000062844
Gene: ENSMUSG00000044937
AA Change: I387T

DomainStartEndE-ValueType
low complexity region 216 229 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
Blast:AAA 336 401 9e-8 BLAST
SCOP:d1jpna2 338 370 1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075632
AA Change: I387T

PolyPhen 2 Score 0.418 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000075059
Gene: ENSMUSG00000044937
AA Change: I387T

DomainStartEndE-ValueType
low complexity region 216 229 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
Pfam:NACHT 337 515 5.4e-10 PFAM
SCOP:d1qqea_ 805 1028 2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000217747
AA Change: I387T

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000219108
AA Change: I387T

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 120,283,089 L1158P probably damaging Het
Acnat1 A T 4: 49,451,077 N11K possibly damaging Het
Ammecr1l T A 18: 31,776,003 I217N possibly damaging Het
Ankrd11 G A 8: 122,908,734 R54* probably null Het
Ccdc178 C T 18: 22,131,414 probably null Het
Ccdc36 G T 9: 108,413,006 T133N possibly damaging Het
Clcn7 T C 17: 25,153,140 S425P probably benign Het
Cnmd A G 14: 79,656,605 V114A probably damaging Het
Col13a1 T C 10: 61,851,162 T651A unknown Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyp3a25 T C 5: 145,986,968 probably null Het
Dmrta1 A T 4: 89,691,616 D271V probably benign Het
Efcab3 T A 11: 105,072,318 probably null Het
Exo5 T C 4: 120,921,997 I224V probably damaging Het
Fam162b C A 10: 51,587,218 A118S probably damaging Het
Glb1 A G 9: 114,454,257 T406A possibly damaging Het
Grk3 T C 5: 112,914,983 N666S probably benign Het
Hars2 T C 18: 36,789,523 F370L possibly damaging Het
Ighv8-11 T G 12: 115,567,603 probably benign Het
Inpp4b A T 8: 81,997,339 D500V probably benign Het
Itgb4 A G 11: 116,006,563 D1534G possibly damaging Het
Kcnk2 G C 1: 189,340,017 T38S possibly damaging Het
Kif16b C T 2: 142,756,122 V527I probably benign Het
Kmt2b A G 7: 30,576,708 Y1789H probably damaging Het
Lpl A C 8: 68,901,243 D412A possibly damaging Het
Lrrc27 T G 7: 139,223,613 L151R probably damaging Het
Muc3 T C 5: 137,154,041 probably benign Het
Nup205 T A 6: 35,208,134 Y829* probably null Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfm4 A G 14: 80,021,752 Y447C probably damaging Het
Olfr1308 T C 2: 111,960,149 Y308C probably benign Het
Pcdhb6 T C 18: 37,335,169 V381A probably benign Het
Prmt2 C T 10: 76,225,415 W79* probably null Het
Skiv2l T C 17: 34,840,385 M1029V probably benign Het
Stil A G 4: 115,016,286 R369G probably null Het
Tubgcp6 A G 15: 89,102,984 L1262P probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Zfp804b T C 5: 6,769,445 H1206R probably damaging Het
Other mutations in Ttc41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Ttc41 APN 10 86736933 missense possibly damaging 0.71
IGL01373:Ttc41 APN 10 86775957 missense possibly damaging 0.61
IGL01636:Ttc41 APN 10 86776678 missense probably benign
IGL01707:Ttc41 APN 10 86776767 missense probably damaging 1.00
IGL01814:Ttc41 APN 10 86731026 missense probably damaging 0.98
IGL01845:Ttc41 APN 10 86776624 missense probably benign 0.03
IGL01918:Ttc41 APN 10 86713190 missense probably damaging 1.00
IGL02374:Ttc41 APN 10 86775951 missense probably damaging 1.00
IGL02489:Ttc41 APN 10 86760914 nonsense probably null
IGL02887:Ttc41 APN 10 86733654 missense probably damaging 1.00
IGL03061:Ttc41 APN 10 86736857 missense possibly damaging 0.65
IGL03077:Ttc41 APN 10 86758348 missense probably damaging 1.00
IGL03210:Ttc41 APN 10 86724414 critical splice donor site probably null
IGL03242:Ttc41 APN 10 86776819 makesense probably null
IGL03307:Ttc41 APN 10 86744440 missense possibly damaging 0.76
BB003:Ttc41 UTSW 10 86776047 missense probably benign 0.10
BB013:Ttc41 UTSW 10 86776047 missense probably benign 0.10
R0071:Ttc41 UTSW 10 86736846 missense probably benign 0.01
R0071:Ttc41 UTSW 10 86736846 missense probably benign 0.01
R0379:Ttc41 UTSW 10 86712977 missense possibly damaging 0.65
R0384:Ttc41 UTSW 10 86763947 missense probably damaging 1.00
R0545:Ttc41 UTSW 10 86759097 missense probably benign 0.00
R1589:Ttc41 UTSW 10 86776390 missense probably benign 0.01
R1599:Ttc41 UTSW 10 86776573 missense probably benign 0.04
R1608:Ttc41 UTSW 10 86775993 missense probably damaging 1.00
R1670:Ttc41 UTSW 10 86776252 missense possibly damaging 0.93
R1938:Ttc41 UTSW 10 86776214 missense probably benign
R2398:Ttc41 UTSW 10 86713386 missense possibly damaging 0.91
R3117:Ttc41 UTSW 10 86724320 missense possibly damaging 0.62
R3119:Ttc41 UTSW 10 86724320 missense possibly damaging 0.62
R4805:Ttc41 UTSW 10 86729798 missense possibly damaging 0.62
R4840:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4841:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4842:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4884:Ttc41 UTSW 10 86731018 missense probably benign 0.00
R4885:Ttc41 UTSW 10 86759102 missense possibly damaging 0.76
R4898:Ttc41 UTSW 10 86776192 missense possibly damaging 0.80
R5067:Ttc41 UTSW 10 86744544 missense probably damaging 0.96
R5253:Ttc41 UTSW 10 86730942 missense probably benign 0.13
R5268:Ttc41 UTSW 10 86744478 missense possibly damaging 0.76
R5297:Ttc41 UTSW 10 86776579 missense probably benign 0.04
R5301:Ttc41 UTSW 10 86719520 missense probably benign 0.00
R5425:Ttc41 UTSW 10 86776630 missense probably damaging 0.96
R5567:Ttc41 UTSW 10 86760920 critical splice donor site probably null
R5635:Ttc41 UTSW 10 86736977 missense probably benign 0.09
R5752:Ttc41 UTSW 10 86758346 missense probably benign 0.33
R5868:Ttc41 UTSW 10 86750264 missense possibly damaging 0.70
R5948:Ttc41 UTSW 10 86713224 missense probably damaging 1.00
R6116:Ttc41 UTSW 10 86759088 critical splice acceptor site probably null
R6247:Ttc41 UTSW 10 86776663 missense probably benign 0.00
R6260:Ttc41 UTSW 10 86731159 missense probably benign 0.20
R6260:Ttc41 UTSW 10 86733707 missense probably benign 0.32
R6276:Ttc41 UTSW 10 86744449 missense probably benign 0.01
R6458:Ttc41 UTSW 10 86758270 missense possibly damaging 0.45
R7170:Ttc41 UTSW 10 86713503 missense probably benign 0.17
R7348:Ttc41 UTSW 10 86750348 nonsense probably null
R7382:Ttc41 UTSW 10 86776510 missense probably damaging 0.97
R7509:Ttc41 UTSW 10 86713432 missense probably damaging 1.00
R7689:Ttc41 UTSW 10 86759224 missense probably damaging 1.00
R7807:Ttc41 UTSW 10 86776631 missense probably benign 0.02
R7926:Ttc41 UTSW 10 86776047 missense probably benign 0.10
R7998:Ttc41 UTSW 10 86736847 missense probably benign 0.01
R8021:Ttc41 UTSW 10 86733714 missense probably benign
R8059:Ttc41 UTSW 10 86712978 missense probably benign 0.01
R8170:Ttc41 UTSW 10 86776166 missense probably damaging 1.00
R8303:Ttc41 UTSW 10 86719630 missense probably benign 0.06
R8375:Ttc41 UTSW 10 86763980 missense probably damaging 0.97
R8383:Ttc41 UTSW 10 86719526 missense probably benign 0.00
R8698:Ttc41 UTSW 10 86712977 missense probably benign 0.00
R8773:Ttc41 UTSW 10 86729815 missense probably benign 0.35
R8902:Ttc41 UTSW 10 86713001 missense probably benign 0.06
R8985:Ttc41 UTSW 10 86731092 missense possibly damaging 0.80
R8988:Ttc41 UTSW 10 86713735 missense possibly damaging 0.88
R9007:Ttc41 UTSW 10 86733761 missense probably damaging 1.00
R9137:Ttc41 UTSW 10 86776622 missense probably benign 0.22
R9236:Ttc41 UTSW 10 86776730 missense probably damaging 1.00
R9248:Ttc41 UTSW 10 86731249 missense probably benign 0.00
R9287:Ttc41 UTSW 10 86763966 missense probably benign 0.43
R9345:Ttc41 UTSW 10 86759225 missense probably damaging 0.99
R9386:Ttc41 UTSW 10 86713026 missense probably damaging 0.99
R9500:Ttc41 UTSW 10 86729862 missense probably benign 0.03
R9570:Ttc41 UTSW 10 86713734 missense possibly damaging 0.88
R9593:Ttc41 UTSW 10 86713185 missense probably benign 0.24
X0024:Ttc41 UTSW 10 86724250 missense probably damaging 1.00
X0064:Ttc41 UTSW 10 86729797 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCAGTATTTGAGCTTACTGCATACCC -3'
(R):5'- CTGGTCTTAGGAACTTTCTGGC -3'

Sequencing Primer
(F):5'- TTCAGAATCAATTCCCTTCCAAC -3'
(R):5'- CTGGCTTTACTTTGACAAGCGAG -3'
Posted On 2014-11-11