Incidental Mutation 'R2401:Olfm4'
ID 248706
Institutional Source Beutler Lab
Gene Symbol Olfm4
Ensembl Gene ENSMUSG00000022026
Gene Name olfactomedin 4
Synonyms GW112, OlfD, pPD4, GC1, LOC239192, LOC380924
MMRRC Submission 040367-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.070) question?
Stock # R2401 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 79984081-80023139 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 80021752 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 447 (Y447C)
Ref Sequence ENSEMBL: ENSMUSP00000154285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088735] [ENSMUST00000228749]
AlphaFold Q3UZZ4
Predicted Effect probably damaging
Transcript: ENSMUST00000088735
AA Change: Y480C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086112
Gene: ENSMUSG00000022026
AA Change: Y480C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
low complexity region 225 243 N/A INTRINSIC
OLF 274 532 8.53e-72 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226541
Predicted Effect probably damaging
Transcript: ENSMUST00000228749
AA Change: Y447C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.5765 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was originally cloned from human myeloblasts and found to be selectively expressed in inflammed colonic epithelium. This gene encodes a member of the olfactomedin family. The encoded protein is an antiapoptotic factor that promotes tumor growth and is an extracellular matrix glycoprotein that facilitates cell adhesion. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced colonization of the gastric mucosa by Helicobacter pylori but increased inflammatory response to H. pylori infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 120,283,089 L1158P probably damaging Het
Acnat1 A T 4: 49,451,077 N11K possibly damaging Het
Ammecr1l T A 18: 31,776,003 I217N possibly damaging Het
Ankrd11 G A 8: 122,908,734 R54* probably null Het
Ccdc178 C T 18: 22,131,414 probably null Het
Ccdc36 G T 9: 108,413,006 T133N possibly damaging Het
Clcn7 T C 17: 25,153,140 S425P probably benign Het
Cnmd A G 14: 79,656,605 V114A probably damaging Het
Col13a1 T C 10: 61,851,162 T651A unknown Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyp3a25 T C 5: 145,986,968 probably null Het
Dmrta1 A T 4: 89,691,616 D271V probably benign Het
Efcab3 T A 11: 105,072,318 probably null Het
Exo5 T C 4: 120,921,997 I224V probably damaging Het
Fam162b C A 10: 51,587,218 A118S probably damaging Het
Glb1 A G 9: 114,454,257 T406A possibly damaging Het
Grk3 T C 5: 112,914,983 N666S probably benign Het
Hars2 T C 18: 36,789,523 F370L possibly damaging Het
Ighv8-11 T G 12: 115,567,603 probably benign Het
Inpp4b A T 8: 81,997,339 D500V probably benign Het
Itgb4 A G 11: 116,006,563 D1534G possibly damaging Het
Kcnk2 G C 1: 189,340,017 T38S possibly damaging Het
Kif16b C T 2: 142,756,122 V527I probably benign Het
Kmt2b A G 7: 30,576,708 Y1789H probably damaging Het
Lpl A C 8: 68,901,243 D412A possibly damaging Het
Lrrc27 T G 7: 139,223,613 L151R probably damaging Het
Muc3 T C 5: 137,154,041 probably benign Het
Nup205 T A 6: 35,208,134 Y829* probably null Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1308 T C 2: 111,960,149 Y308C probably benign Het
Pcdhb6 T C 18: 37,335,169 V381A probably benign Het
Prmt2 C T 10: 76,225,415 W79* probably null Het
Skiv2l T C 17: 34,840,385 M1029V probably benign Het
Stil A G 4: 115,016,286 R369G probably null Het
Ttc41 T C 10: 86,724,374 I387T probably benign Het
Tubgcp6 A G 15: 89,102,984 L1262P probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Zfp804b T C 5: 6,769,445 H1206R probably damaging Het
Other mutations in Olfm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00532:Olfm4 APN 14 80021143 missense probably benign 0.12
IGL01108:Olfm4 APN 14 80021899 missense probably benign 0.15
IGL01599:Olfm4 APN 14 80021310 missense probably damaging 1.00
IGL01872:Olfm4 APN 14 80021928 makesense probably null
IGL01928:Olfm4 APN 14 80011952 missense possibly damaging 0.71
IGL02333:Olfm4 APN 14 80021770 missense probably damaging 1.00
IGL02336:Olfm4 APN 14 80006321 missense probably damaging 1.00
IGL02811:Olfm4 APN 14 80021673 missense probably damaging 1.00
PIT4651001:Olfm4 UTSW 14 80021485 missense probably benign 0.00
R1428:Olfm4 UTSW 14 80021403 missense probably damaging 1.00
R1649:Olfm4 UTSW 14 80011982 missense probably damaging 0.98
R2139:Olfm4 UTSW 14 80014315 missense probably benign 0.00
R2270:Olfm4 UTSW 14 80011875 missense probably damaging 0.96
R4527:Olfm4 UTSW 14 80021224 missense probably benign 0.13
R4649:Olfm4 UTSW 14 80021307 missense probably benign 0.00
R5232:Olfm4 UTSW 14 80021682 missense probably damaging 1.00
R5512:Olfm4 UTSW 14 80021347 missense probably benign 0.32
R6198:Olfm4 UTSW 14 80000373 missense probably benign 0.18
R6642:Olfm4 UTSW 14 80021667 missense probably damaging 1.00
R6828:Olfm4 UTSW 14 80021533 missense probably damaging 1.00
R6916:Olfm4 UTSW 14 80014198 missense probably damaging 0.97
R6960:Olfm4 UTSW 14 80021314 missense probably damaging 0.97
R7329:Olfm4 UTSW 14 80011929 missense possibly damaging 0.79
R7971:Olfm4 UTSW 14 80021800 missense probably damaging 0.98
R8872:Olfm4 UTSW 14 80021503 missense probably damaging 1.00
R9008:Olfm4 UTSW 14 80018167 missense unknown
R9398:Olfm4 UTSW 14 80011809 missense probably benign 0.12
R9599:Olfm4 UTSW 14 80006307 missense probably damaging 1.00
R9600:Olfm4 UTSW 14 80006307 missense probably damaging 1.00
R9784:Olfm4 UTSW 14 80011908 missense probably damaging 0.99
Z1176:Olfm4 UTSW 14 80021219 missense probably benign 0.39
Z1177:Olfm4 UTSW 14 80000452 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- GTGGATGAGCAAGCACTGTG -3'
(R):5'- TCCTTCACCCTAACACTTAGACAGG -3'

Sequencing Primer
(F):5'- ATTTATGCAACTGAGGCCAGC -3'
(R):5'- CCTAACACTTAGACAGGTTGCC -3'
Posted On 2014-11-11