Mutagenetix > Incidental Mutation

Incidental Mutation 'R2401:Skiv2l'

248711

Institutional Source

Beutler Lab

Gene Symbol

Skiv2l

Ensembl Gene

ENSMUSG00000040356

Gene Name

superkiller viralicidic activity 2-like (S. cerevisiae)

Synonyms

4930534J06Rik, Ski2w

MMRRC Submission

040367-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2401 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34839228-34850210 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 34840385 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 1029 (M1029V)

Ref Sequence

ENSEMBL: ENSMUSP00000036265 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046022] [ENSMUST00000046244] [ENSMUST00000077477] [ENSMUST00000159333] [ENSMUST00000161885] [ENSMUST00000172612] [ENSMUST00000173063] [ENSMUST00000173874] [ENSMUST00000174092] [ENSMUST00000180043] [ENSMUST00000173768] [ENSMUST00000173415] [ENSMUST00000173995]

AlphaFold

Q6NZR5

Predicted Effect

probably benign
Transcript: ENSMUST00000046022
AA Change: M1029V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000036265
Gene: ENSMUSG00000040356
AA Change: M1029V

Domain	Start	End	E-Value	Type
low complexity region	7	22	N/A	INTRINSIC
low complexity region	171	176	N/A	INTRINSIC
low complexity region	208	237	N/A	INTRINSIC
low complexity region	269	279	N/A	INTRINSIC
DEXDc	304	487	3.61e-28	SMART
low complexity region	583	592	N/A	INTRINSIC
HELICc	619	705	8.63e-17	SMART
Pfam:rRNA_proc-arch	760	1044	9.7e-39	PFAM
DSHCT	1067	1243	7.67e-77	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000046244

SMART Domains

Protein: ENSMUSP00000047018
Gene: ENSMUSG00000040482

Domain	Start	End	E-Value	Type
low complexity region	168	184	N/A	INTRINSIC
Pfam:RAI1	235	303	2e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000077477

SMART Domains

Protein: ENSMUSP00000076686
Gene: ENSMUSG00000061207

Domain	Start	End	E-Value	Type
Pfam:Stk19	37	251	1e-37	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000159333

SMART Domains

Protein: ENSMUSP00000125311
Gene: ENSMUSG00000061207

Domain	Start	End	E-Value	Type
Pfam:Stk19	1	129	3.2e-16	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160993

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161238

Predicted Effect

probably benign
Transcript: ENSMUST00000161885

Predicted Effect

probably benign
Transcript: ENSMUST00000172612

SMART Domains

Protein: ENSMUSP00000133376
Gene: ENSMUSG00000040482

Domain	Start	End	E-Value	Type
Pfam:RAI1	5	73	1.6e-29	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172686

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172803

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172878

Predicted Effect

probably benign
Transcript: ENSMUST00000173063

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173305

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173403

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184474

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174226

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173644

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183497

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174887

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174363

Predicted Effect

probably benign
Transcript: ENSMUST00000173874

SMART Domains

Protein: ENSMUSP00000134332
Gene: ENSMUSG00000040482

Domain	Start	End	E-Value	Type
low complexity region	168	184	N/A	INTRINSIC
Pfam:RAI1	235	303	4.2e-29	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000174092

SMART Domains

Protein: ENSMUSP00000133587
Gene: ENSMUSG00000040482

Domain	Start	End	E-Value	Type
Pfam:RAI1	110	151	5.3e-15	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000174684

SMART Domains

Protein: ENSMUSP00000134653
Gene: ENSMUSG00000040482

Domain	Start	End	E-Value	Type
PDB:3FQJ\|A	2	48	1e-11	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000174569

SMART Domains

Protein: ENSMUSP00000133448
Gene: ENSMUSG00000040482

Domain	Start	End	E-Value	Type
Pfam:RAI1	15	65	1.3e-15	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000180043

SMART Domains

Protein: ENSMUSP00000137234
Gene: ENSMUSG00000040482

Domain	Start	End	E-Value	Type
low complexity region	168	184	N/A	INTRINSIC
Pfam:RAI1	235	302	2e-25	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173768

SMART Domains

Protein: ENSMUSP00000134052
Gene: ENSMUSG00000040482

Domain	Start	End	E-Value	Type
Pfam:RAI1	1	33	5.6e-15	PFAM
low complexity region	54	64	N/A	INTRINSIC
low complexity region	73	88	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000173415

SMART Domains

Protein: ENSMUSP00000134209
Gene: ENSMUSG00000040356

Domain	Start	End	E-Value	Type
PDB:4A4Z\|A	10	81	8e-14	PDB
Blast:DEXDc	19	76	2e-29	BLAST
Blast:DEXDc	136	242	9e-28	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000173995

SMART Domains

Protein: ENSMUSP00000134583
Gene: ENSMUSG00000040482

Domain	Start	End	E-Value	Type
PDB:3FQJ\|A	1	144	5e-99	PDB

Meta Mutation Damage Score

0.0711

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.0%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a human homologue of yeast SKI2 and may be involved in antiviral activity by blocking translation of poly(A) deficient mRNAs. This gene is located in the class III region of the major histocompatibility complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	T	C	7: 120,283,089	L1158P	probably damaging	Het
Acnat1	A	T	4: 49,451,077	N11K	possibly damaging	Het
Ammecr1l	T	A	18: 31,776,003	I217N	possibly damaging	Het
Ankrd11	G	A	8: 122,908,734	R54*	probably null	Het
Ccdc178	C	T	18: 22,131,414		probably null	Het
Ccdc36	G	T	9: 108,413,006	T133N	possibly damaging	Het
Clcn7	T	C	17: 25,153,140	S425P	probably benign	Het
Cnmd	A	G	14: 79,656,605	V114A	probably damaging	Het
Col13a1	T	C	10: 61,851,162	T651A	unknown	Het
Col1a2	G	A	6: 4,518,822		probably benign	Het
Cyp3a25	T	C	5: 145,986,968		probably null	Het
Dmrta1	A	T	4: 89,691,616	D271V	probably benign	Het
Efcab3	T	A	11: 105,072,318		probably null	Het
Exo5	T	C	4: 120,921,997	I224V	probably damaging	Het
Fam162b	C	A	10: 51,587,218	A118S	probably damaging	Het
Glb1	A	G	9: 114,454,257	T406A	possibly damaging	Het
Grk3	T	C	5: 112,914,983	N666S	probably benign	Het
Hars2	T	C	18: 36,789,523	F370L	possibly damaging	Het
Ighv8-11	T	G	12: 115,567,603		probably benign	Het
Inpp4b	A	T	8: 81,997,339	D500V	probably benign	Het
Itgb4	A	G	11: 116,006,563	D1534G	possibly damaging	Het
Kcnk2	G	C	1: 189,340,017	T38S	possibly damaging	Het
Kif16b	C	T	2: 142,756,122	V527I	probably benign	Het
Kmt2b	A	G	7: 30,576,708	Y1789H	probably damaging	Het
Lpl	A	C	8: 68,901,243	D412A	possibly damaging	Het
Lrrc27	T	G	7: 139,223,613	L151R	probably damaging	Het
Muc3	T	C	5: 137,154,041		probably benign	Het
Nup205	T	A	6: 35,208,134	Y829*	probably null	Het
Obscn	T	C	11: 59,131,646	R758G	possibly damaging	Het
Olfm4	A	G	14: 80,021,752	Y447C	probably damaging	Het
Olfr1308	T	C	2: 111,960,149	Y308C	probably benign	Het
Pcdhb6	T	C	18: 37,335,169	V381A	probably benign	Het
Prmt2	C	T	10: 76,225,415	W79*	probably null	Het
Stil	A	G	4: 115,016,286	R369G	probably null	Het
Ttc41	T	C	10: 86,724,374	I387T	probably benign	Het
Tubgcp6	A	G	15: 89,102,984	L1262P	probably benign	Het
Vmn2r112	T	A	17: 22,603,115	V258E	probably damaging	Het
Zfp804b	T	C	5: 6,769,445	H1206R	probably damaging	Het

Other mutations in Skiv2l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00096:Skiv2l	APN	17	34839548	missense	probably damaging	1.00
IGL00338:Skiv2l	APN	17	34846667	missense	probably damaging	0.99
IGL01284:Skiv2l	APN	17	34839688	unclassified	probably benign
IGL01308:Skiv2l	APN	17	34840634	missense	probably benign	0.19
IGL01874:Skiv2l	APN	17	34841209	missense	probably benign
IGL02114:Skiv2l	APN	17	34841116	missense	probably damaging	0.97
IGL02208:Skiv2l	APN	17	34841675	missense	probably damaging	0.99
IGL02274:Skiv2l	APN	17	34845863	missense	probably damaging	1.00
IGL02729:Skiv2l	APN	17	34839605	missense	possibly damaging	0.63
IGL02839:Skiv2l	APN	17	34847798	missense	probably benign
R0325:Skiv2l	UTSW	17	34844815	missense	possibly damaging	0.50
R1102:Skiv2l	UTSW	17	34840106	missense	probably benign	0.28
R1294:Skiv2l	UTSW	17	34841064	splice site	probably null
R1513:Skiv2l	UTSW	17	34847444	missense	probably damaging	1.00
R1557:Skiv2l	UTSW	17	34848422	missense	probably damaging	1.00
R1747:Skiv2l	UTSW	17	34847806	missense	probably benign	0.02
R3162:Skiv2l	UTSW	17	34847813	nonsense	probably null
R3162:Skiv2l	UTSW	17	34847813	nonsense	probably null
R3695:Skiv2l	UTSW	17	34847912	missense	probably damaging	1.00
R3700:Skiv2l	UTSW	17	34849903	missense	probably benign
R4654:Skiv2l	UTSW	17	34849946	missense	probably damaging	1.00
R4736:Skiv2l	UTSW	17	34848197	missense	possibly damaging	0.91
R4835:Skiv2l	UTSW	17	34842921	missense	possibly damaging	0.66
R5014:Skiv2l	UTSW	17	34847425	missense	probably benign	0.00
R5181:Skiv2l	UTSW	17	34844826	missense	probably benign	0.44
R5223:Skiv2l	UTSW	17	34845166	critical splice donor site	probably null
R5417:Skiv2l	UTSW	17	34846598	missense	probably damaging	0.98
R5623:Skiv2l	UTSW	17	34847432	missense	probably benign	0.00
R5878:Skiv2l	UTSW	17	34846117	missense	possibly damaging	0.83
R5979:Skiv2l	UTSW	17	34841463	missense	probably benign	0.01
R6412:Skiv2l	UTSW	17	34840300	missense	possibly damaging	0.92
R6501:Skiv2l	UTSW	17	34844436	missense	possibly damaging	0.95
R6532:Skiv2l	UTSW	17	34844743	missense	probably damaging	1.00
R6730:Skiv2l	UTSW	17	34845190	nonsense	probably null
R6732:Skiv2l	UTSW	17	34845190	nonsense	probably null
R6741:Skiv2l	UTSW	17	34845190	nonsense	probably null
R6742:Skiv2l	UTSW	17	34845190	nonsense	probably null
R6769:Skiv2l	UTSW	17	34845190	nonsense	probably null
R6771:Skiv2l	UTSW	17	34845190	nonsense	probably null
R7022:Skiv2l	UTSW	17	34845207	missense	possibly damaging	0.88
R7096:Skiv2l	UTSW	17	34841470	missense	probably benign
R7178:Skiv2l	UTSW	17	34839464	missense	probably benign
R7315:Skiv2l	UTSW	17	34841169	missense	probably benign	0.00
R7584:Skiv2l	UTSW	17	34841675	missense	possibly damaging	0.69
R7677:Skiv2l	UTSW	17	34848164	missense	probably benign	0.03
R7796:Skiv2l	UTSW	17	34844418	missense	probably damaging	1.00
R8071:Skiv2l	UTSW	17	34849999	missense	probably benign	0.22
R8407:Skiv2l	UTSW	17	34841127	missense	probably benign	0.00
R8991:Skiv2l	UTSW	17	34840190	missense	probably damaging	1.00
R9016:Skiv2l	UTSW	17	34844664	missense	probably damaging	0.98
R9021:Skiv2l	UTSW	17	34846603	missense	probably damaging	1.00
R9196:Skiv2l	UTSW	17	34849901	missense	probably benign	0.00
R9243:Skiv2l	UTSW	17	34845222	missense	probably benign	0.33
R9322:Skiv2l	UTSW	17	34847463	critical splice acceptor site	probably null
R9475:Skiv2l	UTSW	17	34841102	missense	probably benign
R9564:Skiv2l	UTSW	17	34844782	missense	probably benign
R9565:Skiv2l	UTSW	17	34844782	missense	probably benign
Z1176:Skiv2l	UTSW	17	34841546	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGCCAGCCTCATCCACATAG -3'
(R):5'- TGCAACTCAAGGATGTGGC -3'

Sequencing Primer
(F):5'- ACATAGCCCAGAGTCCGGAG -3'
(R):5'- CAGTGGTAGAAGGTGGGCTCC -3'

Posted On

2014-11-11