Incidental Mutation 'R2401:Ccdc178'
ID 248712
Institutional Source Beutler Lab
Gene Symbol Ccdc178
Ensembl Gene ENSMUSG00000024306
Gene Name coiled coil domain containing 178
Synonyms 4921528I01Rik
MMRRC Submission 040367-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2401 (G1)
Quality Score 149
Status Validated
Chromosome 18
Chromosomal Location 21810897-22171396 bp(-) (GRCm38)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 22131414 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000111503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025160] [ENSMUST00000115837]
AlphaFold Q8CDV0
Predicted Effect probably null
Transcript: ENSMUST00000025160
SMART Domains Protein: ENSMUSP00000025160
Gene: ENSMUSG00000024306

DomainStartEndE-ValueType
coiled coil region 157 204 N/A INTRINSIC
coiled coil region 226 266 N/A INTRINSIC
coiled coil region 292 404 N/A INTRINSIC
coiled coil region 514 541 N/A INTRINSIC
coiled coil region 570 631 N/A INTRINSIC
coiled coil region 665 705 N/A INTRINSIC
low complexity region 720 732 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115837
SMART Domains Protein: ENSMUSP00000111503
Gene: ENSMUSG00000024306

DomainStartEndE-ValueType
coiled coil region 157 204 N/A INTRINSIC
coiled coil region 226 266 N/A INTRINSIC
coiled coil region 292 404 N/A INTRINSIC
coiled coil region 514 541 N/A INTRINSIC
coiled coil region 570 631 N/A INTRINSIC
coiled coil region 665 705 N/A INTRINSIC
low complexity region 720 732 N/A INTRINSIC
Meta Mutation Damage Score 0.9491 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 120,283,089 L1158P probably damaging Het
Acnat1 A T 4: 49,451,077 N11K possibly damaging Het
Ammecr1l T A 18: 31,776,003 I217N possibly damaging Het
Ankrd11 G A 8: 122,908,734 R54* probably null Het
Ccdc36 G T 9: 108,413,006 T133N possibly damaging Het
Clcn7 T C 17: 25,153,140 S425P probably benign Het
Cnmd A G 14: 79,656,605 V114A probably damaging Het
Col13a1 T C 10: 61,851,162 T651A unknown Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyp3a25 T C 5: 145,986,968 probably null Het
Dmrta1 A T 4: 89,691,616 D271V probably benign Het
Efcab3 T A 11: 105,072,318 probably null Het
Exo5 T C 4: 120,921,997 I224V probably damaging Het
Fam162b C A 10: 51,587,218 A118S probably damaging Het
Glb1 A G 9: 114,454,257 T406A possibly damaging Het
Grk3 T C 5: 112,914,983 N666S probably benign Het
Hars2 T C 18: 36,789,523 F370L possibly damaging Het
Ighv8-11 T G 12: 115,567,603 probably benign Het
Inpp4b A T 8: 81,997,339 D500V probably benign Het
Itgb4 A G 11: 116,006,563 D1534G possibly damaging Het
Kcnk2 G C 1: 189,340,017 T38S possibly damaging Het
Kif16b C T 2: 142,756,122 V527I probably benign Het
Kmt2b A G 7: 30,576,708 Y1789H probably damaging Het
Lpl A C 8: 68,901,243 D412A possibly damaging Het
Lrrc27 T G 7: 139,223,613 L151R probably damaging Het
Muc3 T C 5: 137,154,041 probably benign Het
Nup205 T A 6: 35,208,134 Y829* probably null Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfm4 A G 14: 80,021,752 Y447C probably damaging Het
Olfr1308 T C 2: 111,960,149 Y308C probably benign Het
Pcdhb6 T C 18: 37,335,169 V381A probably benign Het
Prmt2 C T 10: 76,225,415 W79* probably null Het
Skiv2l T C 17: 34,840,385 M1029V probably benign Het
Stil A G 4: 115,016,286 R369G probably null Het
Ttc41 T C 10: 86,724,374 I387T probably benign Het
Tubgcp6 A G 15: 89,102,984 L1262P probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Zfp804b T C 5: 6,769,445 H1206R probably damaging Het
Other mutations in Ccdc178
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Ccdc178 APN 18 21844911 missense probably benign 0.05
IGL00743:Ccdc178 APN 18 22145444 splice site probably benign
IGL00906:Ccdc178 APN 18 22135168 nonsense probably null
IGL01352:Ccdc178 APN 18 22018974 splice site probably benign
IGL01553:Ccdc178 APN 18 21915006 missense probably damaging 0.97
IGL01607:Ccdc178 APN 18 22067721 missense probably benign 0.01
IGL01733:Ccdc178 APN 18 22024812 splice site probably benign
IGL01795:Ccdc178 APN 18 22019118 missense probably benign 0.04
IGL01996:Ccdc178 APN 18 22097756 missense probably damaging 0.99
IGL02939:Ccdc178 APN 18 22120718 missense probably benign 0.01
IGL03213:Ccdc178 APN 18 22120691 missense possibly damaging 0.89
IGL03253:Ccdc178 APN 18 21845011 nonsense probably null
IGL03331:Ccdc178 APN 18 21811583 splice site probably null
PIT4520001:Ccdc178 UTSW 18 22067413 missense probably damaging 0.97
R0121:Ccdc178 UTSW 18 21845024 critical splice acceptor site probably null
R0153:Ccdc178 UTSW 18 22150435 missense probably benign 0.00
R0364:Ccdc178 UTSW 18 21915062 missense probably damaging 0.97
R0604:Ccdc178 UTSW 18 22067443 missense probably benign 0.01
R0709:Ccdc178 UTSW 18 22067662 missense probably damaging 0.97
R0961:Ccdc178 UTSW 18 22019041 missense possibly damaging 0.79
R1029:Ccdc178 UTSW 18 22097725 missense possibly damaging 0.89
R1456:Ccdc178 UTSW 18 22150424 missense possibly damaging 0.81
R1481:Ccdc178 UTSW 18 22105621 missense probably benign 0.00
R1596:Ccdc178 UTSW 18 22020873 missense possibly damaging 0.79
R1739:Ccdc178 UTSW 18 22097723 missense possibly damaging 0.92
R1838:Ccdc178 UTSW 18 22067638 missense probably damaging 0.97
R2214:Ccdc178 UTSW 18 21914990 missense possibly damaging 0.73
R2679:Ccdc178 UTSW 18 21811556 missense possibly damaging 0.90
R3051:Ccdc178 UTSW 18 22135131 missense probably benign 0.05
R3150:Ccdc178 UTSW 18 22067652 missense possibly damaging 0.95
R3151:Ccdc178 UTSW 18 21811561 missense probably benign 0.00
R3177:Ccdc178 UTSW 18 22067652 missense possibly damaging 0.95
R3277:Ccdc178 UTSW 18 22067652 missense possibly damaging 0.95
R3903:Ccdc178 UTSW 18 22023095 missense possibly damaging 0.79
R4184:Ccdc178 UTSW 18 22024784 missense probably damaging 1.00
R4258:Ccdc178 UTSW 18 22017335 splice site probably null
R4319:Ccdc178 UTSW 18 22033543 nonsense probably null
R4321:Ccdc178 UTSW 18 22033543 nonsense probably null
R4323:Ccdc178 UTSW 18 22033543 nonsense probably null
R4509:Ccdc178 UTSW 18 22067392 missense possibly damaging 0.94
R4672:Ccdc178 UTSW 18 22150444 nonsense probably null
R5078:Ccdc178 UTSW 18 22067628 critical splice donor site probably null
R5099:Ccdc178 UTSW 18 22105591 missense probably benign
R5679:Ccdc178 UTSW 18 22067429 missense probably benign
R5683:Ccdc178 UTSW 18 22130122 missense probably benign 0.00
R6120:Ccdc178 UTSW 18 22097728 missense probably benign 0.00
R6318:Ccdc178 UTSW 18 22120534 missense possibly damaging 0.90
R6717:Ccdc178 UTSW 18 22020889 missense probably damaging 0.98
R6853:Ccdc178 UTSW 18 22109876 missense probably benign 0.00
R6980:Ccdc178 UTSW 18 22105563 missense probably benign
R7019:Ccdc178 UTSW 18 22150438 missense probably benign 0.00
R7246:Ccdc178 UTSW 18 22109754 missense possibly damaging 0.92
R7322:Ccdc178 UTSW 18 22105549 missense probably benign 0.15
R7340:Ccdc178 UTSW 18 22017461 missense probably benign 0.17
R7371:Ccdc178 UTSW 18 22130138 missense probably benign 0.01
R8003:Ccdc178 UTSW 18 21844887 critical splice donor site probably null
R8371:Ccdc178 UTSW 18 21811504 missense possibly damaging 0.90
R8670:Ccdc178 UTSW 18 22097662 missense possibly damaging 0.89
R8695:Ccdc178 UTSW 18 22024752 missense probably benign 0.02
R8885:Ccdc178 UTSW 18 22067664 missense probably damaging 0.98
R9504:Ccdc178 UTSW 18 22105651 missense possibly damaging 0.89
R9518:Ccdc178 UTSW 18 22145459 missense possibly damaging 0.92
X0063:Ccdc178 UTSW 18 21844912 missense probably benign 0.12
Z1177:Ccdc178 UTSW 18 22109731 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- ACAACGTTCACTCTCACATGAG -3'
(R):5'- TCCTTTGGTAGCATCCATTGAG -3'

Sequencing Primer
(F):5'- TCACATGAGAACTCTATTCCCCC -3'
(R):5'- AGACTCAATGACTCTCTCTTGATAGC -3'
Posted On 2014-11-11