Mutagenetix > Incidental Mutation

Incidental Mutation 'R2401:Hars2'

248714

Institutional Source

Beutler Lab

Gene Symbol

Hars2

Ensembl Gene

ENSMUSG00000019143

Gene Name

histidyl-tRNA synthetase 2

Synonyms

Harsl, HARSR, HO3

MMRRC Submission

040367-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.956) question?

Stock #

R2401 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

36783008-36792562 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 36789523 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 370 (F370L)

Ref Sequence

ENSEMBL: ENSMUSP00000117231 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001419] [ENSMUST00000019287] [ENSMUST00000152954]

AlphaFold

Q99KK9

Predicted Effect

probably benign
Transcript: ENSMUST00000001419

SMART Domains

Protein: ENSMUSP00000001419
Gene: ENSMUSG00000001383

Domain	Start	End	E-Value	Type
ZnF_U1	77	111	2.41e-11	SMART
ZnF_C2H2	80	104	5.48e0	SMART
coiled coil region	118	180	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000019287

SMART Domains

Protein: ENSMUSP00000019287
Gene: ENSMUSG00000019143

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:tRNA-synt_His	61	313	1.3e-23	PFAM
Pfam:tRNA-synt_2b	72	234	2.8e-21	PFAM
Pfam:HGTP_anticodon2	324	424	2.7e-8	PFAM
Pfam:HGTP_anticodon	329	420	2e-18	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124204

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131952

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134122

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145876

Predicted Effect

possibly damaging
Transcript: ENSMUST00000152954
AA Change: F370L

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000117231
Gene: ENSMUSG00000019143
AA Change: F370L

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:tRNA-synt_His	61	389	1e-38	PFAM
Pfam:HGTP_anticodon	410	501	1.8e-16	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155842

Meta Mutation Damage Score

0.7375

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.0%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: This gene encodes a putative member of the class II family of aminoacyl-tRNA synthetases. These enzymes play a critical role in protein biosynthesis by charging tRNAs with their cognate amino acids. This protein is encoded by the nuclear genome but is likely to be imported to the mitochondrion where it is thought to catalyze the ligation of histidine to tRNA molecules. Mutations in a similar gene in human have been associated with Perrault syndrome 2 (PRLTS2). [provided by RefSeq, Mar 2015]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	T	C	7: 120,283,089	L1158P	probably damaging	Het
Acnat1	A	T	4: 49,451,077	N11K	possibly damaging	Het
Ammecr1l	T	A	18: 31,776,003	I217N	possibly damaging	Het
Ankrd11	G	A	8: 122,908,734	R54*	probably null	Het
Ccdc178	C	T	18: 22,131,414		probably null	Het
Ccdc36	G	T	9: 108,413,006	T133N	possibly damaging	Het
Clcn7	T	C	17: 25,153,140	S425P	probably benign	Het
Cnmd	A	G	14: 79,656,605	V114A	probably damaging	Het
Col13a1	T	C	10: 61,851,162	T651A	unknown	Het
Col1a2	G	A	6: 4,518,822		probably benign	Het
Cyp3a25	T	C	5: 145,986,968		probably null	Het
Dmrta1	A	T	4: 89,691,616	D271V	probably benign	Het
Efcab3	T	A	11: 105,072,318		probably null	Het
Exo5	T	C	4: 120,921,997	I224V	probably damaging	Het
Fam162b	C	A	10: 51,587,218	A118S	probably damaging	Het
Glb1	A	G	9: 114,454,257	T406A	possibly damaging	Het
Grk3	T	C	5: 112,914,983	N666S	probably benign	Het
Ighv8-11	T	G	12: 115,567,603		probably benign	Het
Inpp4b	A	T	8: 81,997,339	D500V	probably benign	Het
Itgb4	A	G	11: 116,006,563	D1534G	possibly damaging	Het
Kcnk2	G	C	1: 189,340,017	T38S	possibly damaging	Het
Kif16b	C	T	2: 142,756,122	V527I	probably benign	Het
Kmt2b	A	G	7: 30,576,708	Y1789H	probably damaging	Het
Lpl	A	C	8: 68,901,243	D412A	possibly damaging	Het
Lrrc27	T	G	7: 139,223,613	L151R	probably damaging	Het
Muc3	T	C	5: 137,154,041		probably benign	Het
Nup205	T	A	6: 35,208,134	Y829*	probably null	Het
Obscn	T	C	11: 59,131,646	R758G	possibly damaging	Het
Olfm4	A	G	14: 80,021,752	Y447C	probably damaging	Het
Olfr1308	T	C	2: 111,960,149	Y308C	probably benign	Het
Pcdhb6	T	C	18: 37,335,169	V381A	probably benign	Het
Prmt2	C	T	10: 76,225,415	W79*	probably null	Het
Skiv2l	T	C	17: 34,840,385	M1029V	probably benign	Het
Stil	A	G	4: 115,016,286	R369G	probably null	Het
Ttc41	T	C	10: 86,724,374	I387T	probably benign	Het
Tubgcp6	A	G	15: 89,102,984	L1262P	probably benign	Het
Vmn2r112	T	A	17: 22,603,115	V258E	probably damaging	Het
Zfp804b	T	C	5: 6,769,445	H1206R	probably damaging	Het

Other mutations in Hars2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00715:Hars2	APN	18	36785936	missense	probably damaging	1.00
IGL00955:Hars2	APN	18	36789357	splice site	probably benign
IGL01570:Hars2	APN	18	36787592	missense	probably benign	0.04
IGL01618:Hars2	APN	18	36789577	nonsense	probably null
IGL02165:Hars2	APN	18	36783394	start codon destroyed	probably null	1.00
IGL02290:Hars2	APN	18	36785626	missense	possibly damaging	0.56
IGL02685:Hars2	APN	18	36791118	missense	probably benign	0.18
IGL02805:Hars2	APN	18	36787577	nonsense	probably null
IGL02971:Hars2	APN	18	36786178	missense	probably damaging	1.00
IGL03373:Hars2	APN	18	36785945	missense	probably damaging	0.99
perry	UTSW	18	36790137	missense	possibly damaging	0.64
R0196:Hars2	UTSW	18	36789204	nonsense	probably null
R0543:Hars2	UTSW	18	36789424	missense	probably damaging	1.00
R0549:Hars2	UTSW	18	36786208	critical splice donor site	probably null
R0557:Hars2	UTSW	18	36791077	missense	possibly damaging	0.94
R0893:Hars2	UTSW	18	36787595	missense	possibly damaging	0.56
R1188:Hars2	UTSW	18	36787969	missense	probably damaging	0.99
R1289:Hars2	UTSW	18	36783412	splice site	probably null
R1381:Hars2	UTSW	18	36789217	missense	possibly damaging	0.68
R4119:Hars2	UTSW	18	36790488	missense	probably damaging	0.98
R4351:Hars2	UTSW	18	36786178	missense	probably damaging	1.00
R4404:Hars2	UTSW	18	36785936	missense	probably damaging	1.00
R5372:Hars2	UTSW	18	36790481	missense	possibly damaging	0.93
R5629:Hars2	UTSW	18	36788666	nonsense	probably null
R5886:Hars2	UTSW	18	36790097	intron	probably benign
R7069:Hars2	UTSW	18	36787956	missense	probably damaging	0.99
R7070:Hars2	UTSW	18	36791112	nonsense	probably null
R7188:Hars2	UTSW	18	36790561	missense	probably benign	0.08
R7683:Hars2	UTSW	18	36788236	missense	probably damaging	1.00
R7834:Hars2	UTSW	18	36789581	missense	probably damaging	0.98
R7903:Hars2	UTSW	18	36786192	missense	probably damaging	1.00
R8249:Hars2	UTSW	18	36788001	missense	probably damaging	0.99
R8329:Hars2	UTSW	18	36789235	missense	possibly damaging	0.94
R8362:Hars2	UTSW	18	36790175	missense	probably benign
R9079:Hars2	UTSW	18	36790137	missense	possibly damaging	0.64
R9720:Hars2	UTSW	18	36787554	missense	probably damaging	1.00
RF015:Hars2	UTSW	18	36785945	missense	probably damaging	0.99
Z1177:Hars2	UTSW	18	36789575	missense	probably damaging	1.00
Z1177:Hars2	UTSW	18	36790598	missense	possibly damaging	0.84

Predicted Primers

PCR Primer
(F):5'- AGCTGCTCTTTGAATACCTGAGG -3'
(R):5'- GCAGTAGCAATTCCAAAAGGC -3'

Sequencing Primer
(F):5'- GGGACTGACTAGCTTTTCCATTACAG -3'
(R):5'- TAGCAATTCCAAAAGGCAAAAGGATC -3'

Posted On

2014-11-11