Incidental Mutation 'R2402:Zbtb41'
ID248720
Institutional Source Beutler Lab
Gene Symbol Zbtb41
Ensembl Gene ENSMUSG00000033964
Gene Namezinc finger and BTB domain containing 41
Synonyms9830132G07Rik, 8430415N23Rik
MMRRC Submission 040368-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R2402 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location139422288-139453005 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 139423187 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 13 (E13*)
Ref Sequence ENSEMBL: ENSMUSP00000142797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039867] [ENSMUST00000200243]
Predicted Effect probably null
Transcript: ENSMUST00000039867
AA Change: E13*
SMART Domains Protein: ENSMUSP00000045570
Gene: ENSMUSG00000033964
AA Change: E13*

DomainStartEndE-ValueType
low complexity region 70 81 N/A INTRINSIC
BTB 89 183 7.06e-16 SMART
ZnF_C2H2 208 231 3.78e-1 SMART
low complexity region 234 245 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 301 327 N/A INTRINSIC
ZnF_C2H2 360 382 4.17e-3 SMART
ZnF_C2H2 388 410 8.34e-3 SMART
ZnF_C2H2 421 444 2.67e-1 SMART
ZnF_C2H2 462 484 1.72e-4 SMART
ZnF_C2H2 490 513 1.41e0 SMART
ZnF_C2H2 517 540 1.12e-3 SMART
ZnF_C2H2 546 568 1.36e-2 SMART
ZnF_C2H2 574 596 2.91e-2 SMART
ZnF_C2H2 602 624 7.37e-4 SMART
ZnF_C2H2 630 653 3.39e-3 SMART
ZnF_C2H2 667 689 2.75e-3 SMART
ZnF_C2H2 695 717 3.16e-3 SMART
ZnF_C2H2 723 746 3.34e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199011
Predicted Effect probably null
Transcript: ENSMUST00000200243
AA Change: E13*
SMART Domains Protein: ENSMUSP00000142797
Gene: ENSMUSG00000033964
AA Change: E13*

DomainStartEndE-ValueType
low complexity region 70 81 N/A INTRINSIC
BTB 89 183 4.7e-18 SMART
ZnF_C2H2 208 231 1.6e-3 SMART
low complexity region 234 245 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 301 327 N/A INTRINSIC
ZnF_C2H2 360 382 1.7e-5 SMART
ZnF_C2H2 388 410 3.5e-5 SMART
ZnF_C2H2 421 444 1.1e-3 SMART
ZnF_C2H2 462 484 7.2e-7 SMART
ZnF_C2H2 490 513 5.9e-3 SMART
ZnF_C2H2 517 540 4.7e-6 SMART
ZnF_C2H2 546 568 5.7e-5 SMART
ZnF_C2H2 574 596 1.3e-4 SMART
ZnF_C2H2 602 624 3e-6 SMART
ZnF_C2H2 630 653 1.5e-5 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T A 8: 86,509,141 D1199V probably damaging Het
Abcc6 A T 7: 46,015,575 S277R probably benign Het
Acvrl1 A G 15: 101,137,399 S269G probably damaging Het
Aes T A 10: 81,564,878 C89S possibly damaging Het
Akap10 T C 11: 61,915,222 S227G probably benign Het
Angptl8 T C 9: 21,835,816 probably null Het
Arsi T C 18: 60,916,467 S141P possibly damaging Het
Atic T A 1: 71,569,057 Y303* probably null Het
Bbs9 C T 9: 22,646,063 P510L probably benign Het
Bcl2a1b A G 9: 89,199,742 N128S probably benign Het
Bcl2a1d A T 9: 88,731,496 M75K probably damaging Het
Carm1 T A 9: 21,583,540 L324Q probably damaging Het
Caskin1 T A 17: 24,503,808 L550Q probably damaging Het
Cd302 A G 2: 60,257,068 I142T probably benign Het
Cep350 A T 1: 155,863,136 D2320E probably benign Het
Cgnl1 A G 9: 71,725,179 S297P probably damaging Het
Cr1l T A 1: 195,106,902 Y398F probably benign Het
Ctsa A T 2: 164,834,893 D145V probably benign Het
Ctsj C T 13: 61,000,574 G303D probably damaging Het
Dnah17 T C 11: 118,125,974 I250M probably benign Het
Doc2a C A 7: 126,848,747 C54* probably null Het
Dpy19l2 T C 9: 24,581,248 T685A probably damaging Het
Dtna T A 18: 23,595,478 C243* probably null Het
Exoc3l4 A G 12: 111,422,256 T60A possibly damaging Het
Exph5 C A 9: 53,374,925 S1102* probably null Het
Fam129a A G 1: 151,689,614 T232A probably benign Het
Fhl3 T C 4: 124,705,688 Y19H probably damaging Het
Flt4 A G 11: 49,637,819 E1012G possibly damaging Het
Flvcr2 A G 12: 85,783,003 N262S probably benign Het
Gon4l G T 3: 88,859,043 C463F probably damaging Het
H2-T10 A T 17: 36,117,739 probably null Het
Heatr3 T C 8: 88,144,572 C185R probably benign Het
Hectd1 A G 12: 51,745,534 V2474A probably benign Het
Htr3a C T 9: 48,901,495 E215K probably damaging Het
Ica1l T C 1: 60,006,292 T271A probably benign Het
Klra2 A G 6: 131,243,901 I66T probably benign Het
Neto2 T C 8: 85,690,912 K21R probably benign Het
Nisch T A 14: 31,185,014 probably benign Het
Nr4a1 G T 15: 101,271,737 R296L probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr832 T A 9: 18,945,200 I184N probably damaging Het
Olfr914 T C 9: 38,607,101 V212A probably benign Het
Pcsk5 A T 19: 17,474,834 C1102* probably null Het
Phip C T 9: 82,875,305 A1605T probably benign Het
Pstpip2 T A 18: 77,854,864 M105K possibly damaging Het
Qprt C T 7: 127,108,360 V219I probably benign Het
Ralgapa2 A T 2: 146,353,192 N1271K probably damaging Het
Reg3g A T 6: 78,467,492 L106H probably damaging Het
Rhobtb1 G A 10: 69,270,424 G273D probably benign Het
Rimbp2 T C 5: 128,784,888 D771G probably damaging Het
Sos2 T C 12: 69,596,799 I935V possibly damaging Het
Tcf12 A T 9: 71,856,510 N397K probably damaging Het
Tgtp2 T C 11: 49,059,130 Q205R probably benign Het
Tubb2b T C 13: 34,128,226 N195D probably benign Het
Unc13b A G 4: 43,095,843 T84A probably benign Het
Usb1 T A 8: 95,343,131 F102L probably benign Het
Vmn2r61 A G 7: 42,300,105 T650A possibly damaging Het
Zfp821 C T 8: 109,721,240 S71F probably damaging Het
Other mutations in Zbtb41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Zbtb41 APN 1 139430324 missense probably benign 0.01
IGL01796:Zbtb41 APN 1 139442883 missense probably damaging 0.99
IGL01844:Zbtb41 APN 1 139447327 missense probably benign 0.01
IGL02150:Zbtb41 APN 1 139440448 missense possibly damaging 0.73
IGL02346:Zbtb41 APN 1 139447100 missense probably damaging 1.00
IGL03139:Zbtb41 APN 1 139423838 missense probably benign 0.00
IGL03215:Zbtb41 APN 1 139446950 missense probably damaging 1.00
IGL03309:Zbtb41 APN 1 139432078 critical splice donor site probably null
memorialized UTSW 1 139440394 missense probably benign 0.00
Noted UTSW 1 139439031 missense probably damaging 0.99
unforgotten UTSW 1 139432078 critical splice donor site probably null
R0004:Zbtb41 UTSW 1 139442888 missense possibly damaging 0.90
R0010:Zbtb41 UTSW 1 139423530 missense probably damaging 1.00
R0010:Zbtb41 UTSW 1 139423530 missense probably damaging 1.00
R0048:Zbtb41 UTSW 1 139441834 missense probably damaging 1.00
R0230:Zbtb41 UTSW 1 139446935 missense probably damaging 1.00
R0309:Zbtb41 UTSW 1 139438984 missense probably damaging 0.99
R0458:Zbtb41 UTSW 1 139423476 missense probably damaging 1.00
R0606:Zbtb41 UTSW 1 139423610 missense probably benign 0.28
R0964:Zbtb41 UTSW 1 139439031 missense probably damaging 0.99
R1531:Zbtb41 UTSW 1 139423193 missense probably benign 0.00
R1723:Zbtb41 UTSW 1 139423563 missense probably benign 0.39
R1765:Zbtb41 UTSW 1 139440394 missense probably benign 0.00
R1829:Zbtb41 UTSW 1 139446922 nonsense probably null
R2077:Zbtb41 UTSW 1 139424093 missense probably damaging 1.00
R2292:Zbtb41 UTSW 1 139440359 missense probably damaging 0.99
R2380:Zbtb41 UTSW 1 139423814 missense probably damaging 0.99
R2402:Zbtb41 UTSW 1 139423185 missense probably benign 0.10
R3847:Zbtb41 UTSW 1 139423996 missense probably benign
R3848:Zbtb41 UTSW 1 139423996 missense probably benign
R3849:Zbtb41 UTSW 1 139423996 missense probably benign
R4077:Zbtb41 UTSW 1 139429326 missense probably benign 0.11
R4641:Zbtb41 UTSW 1 139442819 missense probably damaging 0.98
R4772:Zbtb41 UTSW 1 139447414 missense probably damaging 1.00
R5646:Zbtb41 UTSW 1 139423763 missense probably benign 0.05
R5754:Zbtb41 UTSW 1 139432078 critical splice donor site probably null
R6002:Zbtb41 UTSW 1 139423659 missense probably damaging 1.00
R6045:Zbtb41 UTSW 1 139424032 missense probably benign 0.34
R6302:Zbtb41 UTSW 1 139429289 missense possibly damaging 0.67
R6318:Zbtb41 UTSW 1 139430306 missense possibly damaging 0.91
R6430:Zbtb41 UTSW 1 139447207 missense probably benign 0.02
R6906:Zbtb41 UTSW 1 139423390 missense possibly damaging 0.59
R7584:Zbtb41 UTSW 1 139424057 missense probably benign 0.14
R7753:Zbtb41 UTSW 1 139447157 missense probably benign
Z1177:Zbtb41 UTSW 1 139423416 missense not run
Predicted Primers PCR Primer
(F):5'- GGTGGAGCTCTTACCTGATTCTC -3'
(R):5'- GACGGTTGCTTCTGCCTATC -3'

Sequencing Primer
(F):5'- CACTCTTTTTGCAGACCATGAAACG -3'
(R):5'- GCCTATCATCGTTCAAATACTTCAG -3'
Posted On2014-11-11