Mutagenetix > Incidental Mutation

Incidental Mutation 'R2402:Cep350'

248722

Institutional Source

Beutler Lab

Gene Symbol

Cep350

Ensembl Gene

ENSMUSG00000033671

Gene Name

centrosomal protein 350

Synonyms

6430546F08Rik, 4933409L06Rik

MMRRC Submission

040368-MU

Accession Numbers

Genbank: NM_001039184.1; Ensembl: ENSMUST00000138762, ENSMUST00000124495, ENSMUST00000078888

Essential gene?

Probably essential (E-score: 0.960) question?

Stock #

R2402 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

155844964-155973255 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 155863136 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 2320 (D2320E)

Ref Sequence

ENSEMBL: ENSMUSP00000120085 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000138762]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000129865

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132189

Predicted Effect

probably benign
Transcript: ENSMUST00000138762
AA Change: D2320E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000120085
Gene: ENSMUSG00000033671
AA Change: D2320E

Domain	Start	End	E-Value	Type
low complexity region	251	265	N/A	INTRINSIC
low complexity region	376	394	N/A	INTRINSIC
low complexity region	481	491	N/A	INTRINSIC
coiled coil region	596	641	N/A	INTRINSIC
low complexity region	659	669	N/A	INTRINSIC
low complexity region	701	719	N/A	INTRINSIC
low complexity region	754	763	N/A	INTRINSIC
low complexity region	979	994	N/A	INTRINSIC
low complexity region	1153	1175	N/A	INTRINSIC
low complexity region	1250	1267	N/A	INTRINSIC
coiled coil region	1363	1402	N/A	INTRINSIC
low complexity region	1517	1531	N/A	INTRINSIC
low complexity region	1536	1546	N/A	INTRINSIC
low complexity region	1694	1714	N/A	INTRINSIC
coiled coil region	1732	1794	N/A	INTRINSIC
low complexity region	1800	1811	N/A	INTRINSIC
low complexity region	1819	1835	N/A	INTRINSIC
coiled coil region	1853	1893	N/A	INTRINSIC
low complexity region	1980	1994	N/A	INTRINSIC
coiled coil region	2042	2092	N/A	INTRINSIC
low complexity region	2383	2394	N/A	INTRINSIC
low complexity region	2409	2421	N/A	INTRINSIC
low complexity region	2470	2482	N/A	INTRINSIC
CAP_GLY	2486	2551	5.91e-31	SMART
coiled coil region	2700	2731	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192007

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195048

Coding Region Coverage

1x: 99.0%
3x: 98.3%
10x: 96.6%
20x: 92.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a large protein with a CAP-Gly domain typically found in cytoskeleton-associated proteins. The encoded protein primarily localizes to the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. The encoded protein directly interacts with another large centrosomal protein and is required to anchor microtubules at the centrosome. It is also implicated in the regulation of a class of nuclear hormone receptors in the nucleus. Several alternatively spliced transcript variants have been found, but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc12	T	A	8: 86,509,141	D1199V	probably damaging	Het
Abcc6	A	T	7: 46,015,575	S277R	probably benign	Het
Acvrl1	A	G	15: 101,137,399	S269G	probably damaging	Het
Aes	T	A	10: 81,564,878	C89S	possibly damaging	Het
Akap10	T	C	11: 61,915,222	S227G	probably benign	Het
Angptl8	T	C	9: 21,835,816		probably null	Het
Arsi	T	C	18: 60,916,467	S141P	possibly damaging	Het
Atic	T	A	1: 71,569,057	Y303*	probably null	Het
Bbs9	C	T	9: 22,646,063	P510L	probably benign	Het
Bcl2a1b	A	G	9: 89,199,742	N128S	probably benign	Het
Bcl2a1d	A	T	9: 88,731,496	M75K	probably damaging	Het
Carm1	T	A	9: 21,583,540	L324Q	probably damaging	Het
Caskin1	T	A	17: 24,503,808	L550Q	probably damaging	Het
Cd302	A	G	2: 60,257,068	I142T	probably benign	Het
Cgnl1	A	G	9: 71,725,179	S297P	probably damaging	Het
Cr1l	T	A	1: 195,106,902	Y398F	probably benign	Het
Ctsa	A	T	2: 164,834,893	D145V	probably benign	Het
Ctsj	C	T	13: 61,000,574	G303D	probably damaging	Het
Dnah17	T	C	11: 118,125,974	I250M	probably benign	Het
Doc2a	C	A	7: 126,848,747	C54*	probably null	Het
Dpy19l2	T	C	9: 24,581,248	T685A	probably damaging	Het
Dtna	T	A	18: 23,595,478	C243*	probably null	Het
Exoc3l4	A	G	12: 111,422,256	T60A	possibly damaging	Het
Exph5	C	A	9: 53,374,925	S1102*	probably null	Het
Fam129a	A	G	1: 151,689,614	T232A	probably benign	Het
Fhl3	T	C	4: 124,705,688	Y19H	probably damaging	Het
Flt4	A	G	11: 49,637,819	E1012G	possibly damaging	Het
Flvcr2	A	G	12: 85,783,003	N262S	probably benign	Het
Gon4l	G	T	3: 88,859,043	C463F	probably damaging	Het
H2-T10	A	T	17: 36,117,739		probably null	Het
Heatr3	T	C	8: 88,144,572	C185R	probably benign	Het
Hectd1	A	G	12: 51,745,534	V2474A	probably benign	Het
Htr3a	C	T	9: 48,901,495	E215K	probably damaging	Het
Ica1l	T	C	1: 60,006,292	T271A	probably benign	Het
Klra2	A	G	6: 131,243,901	I66T	probably benign	Het
Neto2	T	C	8: 85,690,912	K21R	probably benign	Het
Nisch	T	A	14: 31,185,014		probably benign	Het
Nr4a1	G	T	15: 101,271,737	R296L	probably damaging	Het
Obscn	T	C	11: 59,131,646	R758G	possibly damaging	Het
Olfr832	T	A	9: 18,945,200	I184N	probably damaging	Het
Olfr914	T	C	9: 38,607,101	V212A	probably benign	Het
Pcsk5	A	T	19: 17,474,834	C1102*	probably null	Het
Phip	C	T	9: 82,875,305	A1605T	probably benign	Het
Pstpip2	T	A	18: 77,854,864	M105K	possibly damaging	Het
Qprt	C	T	7: 127,108,360	V219I	probably benign	Het
Ralgapa2	A	T	2: 146,353,192	N1271K	probably damaging	Het
Reg3g	A	T	6: 78,467,492	L106H	probably damaging	Het
Rhobtb1	G	A	10: 69,270,424	G273D	probably benign	Het
Rimbp2	T	C	5: 128,784,888	D771G	probably damaging	Het
Sos2	T	C	12: 69,596,799	I935V	possibly damaging	Het
Tcf12	A	T	9: 71,856,510	N397K	probably damaging	Het
Tgtp2	T	C	11: 49,059,130	Q205R	probably benign	Het
Tubb2b	T	C	13: 34,128,226	N195D	probably benign	Het
Unc13b	A	G	4: 43,095,843	T84A	probably benign	Het
Usb1	T	A	8: 95,343,131	F102L	probably benign	Het
Vmn2r61	A	G	7: 42,300,105	T650A	possibly damaging	Het
Zbtb41	A	C	1: 139,423,185	D12A	probably benign	Het
Zbtb41	G	T	1: 139,423,187	E13*	probably null	Het
Zfp821	C	T	8: 109,721,240	S71F	probably damaging	Het

Other mutations in Cep350

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00764:Cep350	APN	1	155940746	missense	possibly damaging	0.68
IGL00821:Cep350	APN	1	155862204	missense	probably benign
IGL00837:Cep350	APN	1	155953391	missense	probably damaging	1.00
IGL00977:Cep350	APN	1	155932865	missense	probably null	0.99
IGL01544:Cep350	APN	1	155953187	missense	probably damaging	1.00
IGL01616:Cep350	APN	1	155953247	missense	probably benign	0.00
IGL01695:Cep350	APN	1	155944158	missense	probably damaging	1.00
IGL01902:Cep350	APN	1	155861985	missense	probably damaging	1.00
IGL01977:Cep350	APN	1	155911968	missense	probably benign	0.01
IGL02388:Cep350	APN	1	155953753	missense	probably benign	0.28
IGL02475:Cep350	APN	1	155862595	missense	probably damaging	1.00
IGL02528:Cep350	APN	1	155894615	missense	probably damaging	1.00
IGL02598:Cep350	APN	1	155862967	missense	probably benign	0.00
IGL02676:Cep350	APN	1	155862231	missense	possibly damaging	0.82
IGL02728:Cep350	APN	1	155953222	missense	probably benign	0.02
IGL02744:Cep350	APN	1	155931533	missense	probably damaging	0.98
IGL02817:Cep350	APN	1	155928842	missense	probably damaging	1.00
IGL02892:Cep350	APN	1	155868806	missense	possibly damaging	0.51
IGL03156:Cep350	APN	1	155858042	missense	probably damaging	1.00
IGL03166:Cep350	APN	1	155863600	missense	possibly damaging	0.78
IGL03216:Cep350	APN	1	155860627	missense	probably benign	0.06
IGL03268:Cep350	APN	1	155953549	missense	probably benign	0.16
IGL03358:Cep350	APN	1	155928539	missense	probably benign
primed	UTSW	1	155953588	missense	probably damaging	0.98
stoked	UTSW	1	155915575	missense	probably benign	0.03
NA:Cep350	UTSW	1	155958648	missense	probably damaging	1.00
R0060:Cep350	UTSW	1	155928626	missense	probably damaging	1.00
R0060:Cep350	UTSW	1	155928626	missense	probably damaging	1.00
R0066:Cep350	UTSW	1	155911218	missense	probably damaging	0.99
R0066:Cep350	UTSW	1	155911218	missense	probably damaging	0.99
R0172:Cep350	UTSW	1	155953447	missense	probably benign	0.00
R0365:Cep350	UTSW	1	155906571	missense	probably benign	0.00
R0472:Cep350	UTSW	1	155914723	missense	probably damaging	0.99
R0502:Cep350	UTSW	1	155900883	splice site	probably null
R0538:Cep350	UTSW	1	155848620	missense	possibly damaging	0.80
R0547:Cep350	UTSW	1	155901435	splice site	probably null
R0565:Cep350	UTSW	1	155961195	splice site	probably benign
R0607:Cep350	UTSW	1	155872048	missense	probably damaging	1.00
R0645:Cep350	UTSW	1	155940712	splice site	probably null
R0675:Cep350	UTSW	1	155959753	missense	possibly damaging	0.63
R0828:Cep350	UTSW	1	155953246	missense	probably benign	0.00
R0863:Cep350	UTSW	1	155862235	missense	probably benign	0.00
R0969:Cep350	UTSW	1	155940826	missense	possibly damaging	0.81
R1102:Cep350	UTSW	1	155931518	missense	probably damaging	1.00
R1186:Cep350	UTSW	1	155875376	missense	probably damaging	1.00
R1552:Cep350	UTSW	1	155910738	missense	possibly damaging	0.92
R1560:Cep350	UTSW	1	155929079	missense	possibly damaging	0.48
R1698:Cep350	UTSW	1	155953358	missense	possibly damaging	0.62
R1729:Cep350	UTSW	1	155911981	missense	probably benign	0.17
R1735:Cep350	UTSW	1	155953214	missense	probably damaging	0.99
R1740:Cep350	UTSW	1	155928833	missense	probably damaging	1.00
R1783:Cep350	UTSW	1	155928865	missense	probably damaging	1.00
R1844:Cep350	UTSW	1	155848628	missense	probably damaging	0.99
R1848:Cep350	UTSW	1	155953651	missense	probably benign	0.28
R1988:Cep350	UTSW	1	155933104	missense	possibly damaging	0.82
R2008:Cep350	UTSW	1	155914721	missense	probably benign	0.16
R2241:Cep350	UTSW	1	155958556	splice site	probably null
R2245:Cep350	UTSW	1	155879020	missense	probably benign	0.10
R2566:Cep350	UTSW	1	155959718	critical splice donor site	probably null
R3160:Cep350	UTSW	1	155863164	missense	probably benign	0.00
R3162:Cep350	UTSW	1	155863164	missense	probably benign	0.00
R3769:Cep350	UTSW	1	155953204	missense	probably damaging	1.00
R4035:Cep350	UTSW	1	155959795	missense	probably benign	0.06
R4158:Cep350	UTSW	1	155932875	missense	probably damaging	1.00
R4160:Cep350	UTSW	1	155932875	missense	probably damaging	1.00
R4213:Cep350	UTSW	1	155935961	missense	probably damaging	1.00
R4483:Cep350	UTSW	1	155926468	missense	probably benign	0.01
R4648:Cep350	UTSW	1	155902598	missense	possibly damaging	0.85
R4694:Cep350	UTSW	1	155928586	missense	probably damaging	1.00
R4836:Cep350	UTSW	1	155928833	missense	probably damaging	1.00
R4839:Cep350	UTSW	1	155928494	missense	probably benign	0.00
R4969:Cep350	UTSW	1	155860279	missense	probably damaging	0.99
R5014:Cep350	UTSW	1	155928206	missense	probably benign	0.00
R5027:Cep350	UTSW	1	155933354	missense	probably benign	0.01
R5144:Cep350	UTSW	1	155911150	missense	probably damaging	0.99
R5153:Cep350	UTSW	1	155935946	missense	probably damaging	1.00
R5165:Cep350	UTSW	1	155928368	missense	probably damaging	1.00
R5182:Cep350	UTSW	1	155858108	missense	probably damaging	1.00
R5445:Cep350	UTSW	1	155894723	missense	probably benign	0.01
R5738:Cep350	UTSW	1	155866078	missense	probably damaging	1.00
R5809:Cep350	UTSW	1	155933341	missense	probably damaging	0.98
R5855:Cep350	UTSW	1	155953762	missense	probably benign	0.00
R6103:Cep350	UTSW	1	155924576	missense	probably benign	0.05
R6139:Cep350	UTSW	1	155953279	missense	probably benign	0.03
R6285:Cep350	UTSW	1	155953374	missense	possibly damaging	0.48
R6430:Cep350	UTSW	1	155894673	missense	probably damaging	1.00
R6446:Cep350	UTSW	1	155862154	missense	probably benign
R6520:Cep350	UTSW	1	155933336	missense	probably benign	0.02
R6712:Cep350	UTSW	1	155858106	missense	possibly damaging	0.93
R6940:Cep350	UTSW	1	155928551	missense	probably benign	0.01
R7020:Cep350	UTSW	1	155928331	missense	probably damaging	1.00
R7056:Cep350	UTSW	1	155848627	missense	probably damaging	1.00
R7141:Cep350	UTSW	1	155914748	missense	probably damaging	1.00
R7215:Cep350	UTSW	1	155894707	missense	possibly damaging	0.89
R7247:Cep350	UTSW	1	155910753	missense	probably damaging	1.00
R7272:Cep350	UTSW	1	155953588	missense	probably damaging	0.98
R7336:Cep350	UTSW	1	155862276	missense	probably benign	0.17
R7361:Cep350	UTSW	1	155901491	missense	probably damaging	1.00
R7390:Cep350	UTSW	1	155866087	missense	possibly damaging	0.94
R7402:Cep350	UTSW	1	155928215	missense	probably benign	0.00
R7428:Cep350	UTSW	1	155894619	missense	probably benign	0.00
R7440:Cep350	UTSW	1	155940772	missense	probably damaging	0.98
R7520:Cep350	UTSW	1	155915629	missense	probably benign	0.05
R7529:Cep350	UTSW	1	155861923	missense	probably benign	0.08
R7635:Cep350	UTSW	1	155879021	nonsense	probably null
R7806:Cep350	UTSW	1	155862063	missense	probably benign	0.00
R8100:Cep350	UTSW	1	155953402	missense	probably damaging	0.97
R8192:Cep350	UTSW	1	155940783	missense	possibly damaging	0.94
R8193:Cep350	UTSW	1	155862079	missense	probably benign	0.01
R8351:Cep350	UTSW	1	155872034	missense	probably damaging	0.99
R8406:Cep350	UTSW	1	155922418	missense	probably benign	0.00
R8451:Cep350	UTSW	1	155872034	missense	probably damaging	0.99
R8467:Cep350	UTSW	1	155915575	missense	probably benign	0.03
R8543:Cep350	UTSW	1	155862376	missense	probably damaging	0.98
R8714:Cep350	UTSW	1	155860731	missense	probably damaging	0.98
R8810:Cep350	UTSW	1	155928116	missense	probably damaging	1.00
R8837:Cep350	UTSW	1	155861772	missense	probably benign	0.09
R8933:Cep350	UTSW	1	155863415	missense	probably benign	0.01
R9043:Cep350	UTSW	1	155897482	missense	probably damaging	1.00
R9050:Cep350	UTSW	1	155862941	missense	possibly damaging	0.81
R9067:Cep350	UTSW	1	155861739	missense	probably benign	0.00
R9105:Cep350	UTSW	1	155959815	missense	probably damaging	1.00
R9295:Cep350	UTSW	1	155862305	nonsense	probably null
R9304:Cep350	UTSW	1	155953718	missense	probably damaging	0.98
R9456:Cep350	UTSW	1	155868711	missense	probably benign	0.00
R9575:Cep350	UTSW	1	155875367	missense	probably benign	0.03
R9715:Cep350	UTSW	1	155875361	missense	probably benign	0.00
R9749:Cep350	UTSW	1	155953239	missense	probably benign	0.02
R9758:Cep350	UTSW	1	155894687	missense	probably damaging	0.96
R9767:Cep350	UTSW	1	155863272	missense	probably benign	0.01
RF020:Cep350	UTSW	1	155915478	missense	probably benign	0.34
X0018:Cep350	UTSW	1	155953286	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- ACTGAGAGTCCTTCCTGAGC -3'
(R):5'- AGGTTGAAGATGCCTGCTGTAAG -3'

Sequencing Primer
(F):5'- AGTCCTTCCTGAGCGACGATG -3'
(R):5'- CTGTAAGCAGTCAGGCGGATC -3'

Posted On

2014-11-11