Incidental Mutation 'R2402:Fhl3'
ID248734
Institutional Source Beutler Lab
Gene Symbol Fhl3
Ensembl Gene ENSMUSG00000032643
Gene Namefour and a half LIM domains 3
Synonyms
MMRRC Submission 040368-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.320) question?
Stock #R2402 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location124700701-124708611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124705688 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 19 (Y19H)
Ref Sequence ENSEMBL: ENSMUSP00000121702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038684] [ENSMUST00000106199] [ENSMUST00000145942]
Predicted Effect probably damaging
Transcript: ENSMUST00000038684
AA Change: Y19H

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000040150
Gene: ENSMUSG00000032643
AA Change: Y19H

DomainStartEndE-ValueType
LIM 39 92 2.7e-11 SMART
LIM 100 153 1.67e-16 SMART
LIM 161 212 4.48e-17 SMART
LIM 220 284 2.91e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106199
AA Change: Y19H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101805
Gene: ENSMUSG00000032643
AA Change: Y19H

DomainStartEndE-ValueType
LIM 39 92 2.7e-11 SMART
LIM 100 153 1.67e-16 SMART
LIM 161 212 4.48e-17 SMART
LIM 220 275 8.49e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000145942
AA Change: Y19H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121702
Gene: ENSMUSG00000032643
AA Change: Y19H

DomainStartEndE-ValueType
Blast:LIM 1 31 5e-6 BLAST
LIM 39 92 2.7e-11 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of proteins containing a four-and-a-half LIM domain, which is a highly conserved double zinc finger motif. The encoded protein has been shown to interact with the cancer developmental regulators SMAD2, SMAD3, and SMAD4, the skeletal muscle myogenesis protein MyoD, and the high-affinity IgE beta chain regulator MZF-1. This protein may be involved in tumor suppression, repression of MyoD expression, and repression of IgE receptor expression. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T A 8: 86,509,141 D1199V probably damaging Het
Abcc6 A T 7: 46,015,575 S277R probably benign Het
Acvrl1 A G 15: 101,137,399 S269G probably damaging Het
Aes T A 10: 81,564,878 C89S possibly damaging Het
Akap10 T C 11: 61,915,222 S227G probably benign Het
Angptl8 T C 9: 21,835,816 probably null Het
Arsi T C 18: 60,916,467 S141P possibly damaging Het
Atic T A 1: 71,569,057 Y303* probably null Het
Bbs9 C T 9: 22,646,063 P510L probably benign Het
Bcl2a1b A G 9: 89,199,742 N128S probably benign Het
Bcl2a1d A T 9: 88,731,496 M75K probably damaging Het
Carm1 T A 9: 21,583,540 L324Q probably damaging Het
Caskin1 T A 17: 24,503,808 L550Q probably damaging Het
Cd302 A G 2: 60,257,068 I142T probably benign Het
Cep350 A T 1: 155,863,136 D2320E probably benign Het
Cgnl1 A G 9: 71,725,179 S297P probably damaging Het
Cr1l T A 1: 195,106,902 Y398F probably benign Het
Ctsa A T 2: 164,834,893 D145V probably benign Het
Ctsj C T 13: 61,000,574 G303D probably damaging Het
Dnah17 T C 11: 118,125,974 I250M probably benign Het
Doc2a C A 7: 126,848,747 C54* probably null Het
Dpy19l2 T C 9: 24,581,248 T685A probably damaging Het
Dtna T A 18: 23,595,478 C243* probably null Het
Exoc3l4 A G 12: 111,422,256 T60A possibly damaging Het
Exph5 C A 9: 53,374,925 S1102* probably null Het
Fam129a A G 1: 151,689,614 T232A probably benign Het
Flt4 A G 11: 49,637,819 E1012G possibly damaging Het
Flvcr2 A G 12: 85,783,003 N262S probably benign Het
Gon4l G T 3: 88,859,043 C463F probably damaging Het
H2-T10 A T 17: 36,117,739 probably null Het
Heatr3 T C 8: 88,144,572 C185R probably benign Het
Hectd1 A G 12: 51,745,534 V2474A probably benign Het
Htr3a C T 9: 48,901,495 E215K probably damaging Het
Ica1l T C 1: 60,006,292 T271A probably benign Het
Klra2 A G 6: 131,243,901 I66T probably benign Het
Neto2 T C 8: 85,690,912 K21R probably benign Het
Nisch T A 14: 31,185,014 probably benign Het
Nr4a1 G T 15: 101,271,737 R296L probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr832 T A 9: 18,945,200 I184N probably damaging Het
Olfr914 T C 9: 38,607,101 V212A probably benign Het
Pcsk5 A T 19: 17,474,834 C1102* probably null Het
Phip C T 9: 82,875,305 A1605T probably benign Het
Pstpip2 T A 18: 77,854,864 M105K possibly damaging Het
Qprt C T 7: 127,108,360 V219I probably benign Het
Ralgapa2 A T 2: 146,353,192 N1271K probably damaging Het
Reg3g A T 6: 78,467,492 L106H probably damaging Het
Rhobtb1 G A 10: 69,270,424 G273D probably benign Het
Rimbp2 T C 5: 128,784,888 D771G probably damaging Het
Sos2 T C 12: 69,596,799 I935V possibly damaging Het
Tcf12 A T 9: 71,856,510 N397K probably damaging Het
Tgtp2 T C 11: 49,059,130 Q205R probably benign Het
Tubb2b T C 13: 34,128,226 N195D probably benign Het
Unc13b A G 4: 43,095,843 T84A probably benign Het
Usb1 T A 8: 95,343,131 F102L probably benign Het
Vmn2r61 A G 7: 42,300,105 T650A possibly damaging Het
Zbtb41 A C 1: 139,423,185 D12A probably benign Het
Zbtb41 G T 1: 139,423,187 E13* probably null Het
Zfp821 C T 8: 109,721,240 S71F probably damaging Het
Other mutations in Fhl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0592:Fhl3 UTSW 4 124705677 missense probably benign 0.23
R1118:Fhl3 UTSW 4 124705791 critical splice donor site probably null
R2921:Fhl3 UTSW 4 124705670 missense probably damaging 1.00
R2923:Fhl3 UTSW 4 124705670 missense probably damaging 1.00
R4583:Fhl3 UTSW 4 124707549 missense probably benign 0.41
R5147:Fhl3 UTSW 4 124707931 missense probably benign 0.01
R5460:Fhl3 UTSW 4 124706003 missense probably damaging 1.00
R5932:Fhl3 UTSW 4 124705727 missense probably damaging 1.00
R6855:Fhl3 UTSW 4 124707522 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACATGCTCTGACCTGGCATC -3'
(R):5'- CTCATAGAACAGTTCCTTCGGG -3'

Sequencing Primer
(F):5'- ATGCTCTGACCTGGCATCTTCTATG -3'
(R):5'- AACAGTTCCTTCGGGGAGAC -3'
Posted On2014-11-11