Incidental Mutation 'R2402:Reg3g'
ID248739
Institutional Source Beutler Lab
Gene Symbol Reg3g
Ensembl Gene ENSMUSG00000030017
Gene Nameregenerating islet-derived 3 gamma
SynonymsRegIII (gamma)
MMRRC Submission 040368-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2402 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location78466269-78468872 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 78467492 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 106 (L106H)
Ref Sequence ENSEMBL: ENSMUSP00000032089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032089]
Predicted Effect probably damaging
Transcript: ENSMUST00000032089
AA Change: L106H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032089
Gene: ENSMUSG00000030017
AA Change: L106H

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CLECT 40 171 1.79e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176650
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a C-type lectin that demonstrates bactericidal activity. This gene is predominantly expressed in the distal small intestine where the encoded protein undergoes proteolytic processing by trypsin. Mice lacking the encoded protein exhibit altered mucus distribution, increased bacterial contact with the epithelium, and elevated inflammatory markers in the ileum, and low-grade inflammation. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mice homozygous for a knock-out allele eshibit increased mucosal bacterial loads, T-helper 1 cells, and intestinal permeability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T A 8: 86,509,141 D1199V probably damaging Het
Abcc6 A T 7: 46,015,575 S277R probably benign Het
Acvrl1 A G 15: 101,137,399 S269G probably damaging Het
Aes T A 10: 81,564,878 C89S possibly damaging Het
Akap10 T C 11: 61,915,222 S227G probably benign Het
Angptl8 T C 9: 21,835,816 probably null Het
Arsi T C 18: 60,916,467 S141P possibly damaging Het
Atic T A 1: 71,569,057 Y303* probably null Het
Bbs9 C T 9: 22,646,063 P510L probably benign Het
Bcl2a1b A G 9: 89,199,742 N128S probably benign Het
Bcl2a1d A T 9: 88,731,496 M75K probably damaging Het
Carm1 T A 9: 21,583,540 L324Q probably damaging Het
Caskin1 T A 17: 24,503,808 L550Q probably damaging Het
Cd302 A G 2: 60,257,068 I142T probably benign Het
Cep350 A T 1: 155,863,136 D2320E probably benign Het
Cgnl1 A G 9: 71,725,179 S297P probably damaging Het
Cr1l T A 1: 195,106,902 Y398F probably benign Het
Ctsa A T 2: 164,834,893 D145V probably benign Het
Ctsj C T 13: 61,000,574 G303D probably damaging Het
Dnah17 T C 11: 118,125,974 I250M probably benign Het
Doc2a C A 7: 126,848,747 C54* probably null Het
Dpy19l2 T C 9: 24,581,248 T685A probably damaging Het
Dtna T A 18: 23,595,478 C243* probably null Het
Exoc3l4 A G 12: 111,422,256 T60A possibly damaging Het
Exph5 C A 9: 53,374,925 S1102* probably null Het
Fam129a A G 1: 151,689,614 T232A probably benign Het
Fhl3 T C 4: 124,705,688 Y19H probably damaging Het
Flt4 A G 11: 49,637,819 E1012G possibly damaging Het
Flvcr2 A G 12: 85,783,003 N262S probably benign Het
Gon4l G T 3: 88,859,043 C463F probably damaging Het
H2-T10 A T 17: 36,117,739 probably null Het
Heatr3 T C 8: 88,144,572 C185R probably benign Het
Hectd1 A G 12: 51,745,534 V2474A probably benign Het
Htr3a C T 9: 48,901,495 E215K probably damaging Het
Ica1l T C 1: 60,006,292 T271A probably benign Het
Klra2 A G 6: 131,243,901 I66T probably benign Het
Neto2 T C 8: 85,690,912 K21R probably benign Het
Nisch T A 14: 31,185,014 probably benign Het
Nr4a1 G T 15: 101,271,737 R296L probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr832 T A 9: 18,945,200 I184N probably damaging Het
Olfr914 T C 9: 38,607,101 V212A probably benign Het
Pcsk5 A T 19: 17,474,834 C1102* probably null Het
Phip C T 9: 82,875,305 A1605T probably benign Het
Pstpip2 T A 18: 77,854,864 M105K possibly damaging Het
Qprt C T 7: 127,108,360 V219I probably benign Het
Ralgapa2 A T 2: 146,353,192 N1271K probably damaging Het
Rhobtb1 G A 10: 69,270,424 G273D probably benign Het
Rimbp2 T C 5: 128,784,888 D771G probably damaging Het
Sos2 T C 12: 69,596,799 I935V possibly damaging Het
Tcf12 A T 9: 71,856,510 N397K probably damaging Het
Tgtp2 T C 11: 49,059,130 Q205R probably benign Het
Tubb2b T C 13: 34,128,226 N195D probably benign Het
Unc13b A G 4: 43,095,843 T84A probably benign Het
Usb1 T A 8: 95,343,131 F102L probably benign Het
Vmn2r61 A G 7: 42,300,105 T650A possibly damaging Het
Zbtb41 A C 1: 139,423,185 D12A probably benign Het
Zbtb41 G T 1: 139,423,187 E13* probably null Het
Zfp821 C T 8: 109,721,240 S71F probably damaging Het
Other mutations in Reg3g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Reg3g APN 6 78466779 missense probably benign
IGL01778:Reg3g APN 6 78466833 missense probably benign
R0389:Reg3g UTSW 6 78468561 start codon destroyed probably null 1.00
R0513:Reg3g UTSW 6 78467844 nonsense probably null
R0562:Reg3g UTSW 6 78467488 missense possibly damaging 0.91
R1872:Reg3g UTSW 6 78467853 nonsense probably null
R4896:Reg3g UTSW 6 78467810 missense probably benign
R5113:Reg3g UTSW 6 78466561 splice site probably null
R7352:Reg3g UTSW 6 78466859 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCACAGAGCTTAGGAACTTTC -3'
(R):5'- AAGTGGGCTCCAATTTCCAC -3'

Sequencing Primer
(F):5'- CCACAGAGCTTAGGAACTTTCTTTTG -3'
(R):5'- CCACAGTTTCTTGAGAATCACAATG -3'
Posted On2014-11-11