Incidental Mutation 'R2402:Neto2'
ID 248748
Institutional Source Beutler Lab
Gene Symbol Neto2
Ensembl Gene ENSMUSG00000036902
Gene Name neuropilin (NRP) and tolloid (TLL)-like 2
Synonyms 5530601C23Rik
MMRRC Submission 040368-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.164) question?
Stock # R2402 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 86363217-86427553 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 86417541 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 21 (K21R)
Ref Sequence ENSEMBL: ENSMUSP00000105308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109686] [ENSMUST00000209479] [ENSMUST00000216286]
AlphaFold Q8BNJ6
Predicted Effect probably benign
Transcript: ENSMUST00000109686
AA Change: K21R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105308
Gene: ENSMUSG00000036902
AA Change: K21R

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
CUB 80 194 2.56e-40 SMART
CUB 205 320 9.11e-5 SMART
LDLa 324 361 5.73e-5 SMART
transmembrane domain 374 396 N/A INTRINSIC
coiled coil region 432 460 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209259
Predicted Effect probably benign
Transcript: ENSMUST00000209479
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215046
Predicted Effect probably benign
Transcript: ENSMUST00000216286
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a predicted transmembrane protein containing two extracellular CUB domains followed by a low-density lipoprotein class A (LDLa) domain. A similar gene in rats encodes a protein that modulates glutamate signaling in the brain by regulating kainate receptor function. Expression of this gene may be a biomarker for proliferating infantile hemangiomas. A pseudogene of this gene is located on the long arm of chromosome 8. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a null mutation show normal brain morphology and kainate receptor mediated excitatory postsynaptic currents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T A 8: 87,235,770 (GRCm39) D1199V probably damaging Het
Abcc6 A T 7: 45,664,999 (GRCm39) S277R probably benign Het
Acvrl1 A G 15: 101,035,280 (GRCm39) S269G probably damaging Het
Akap10 T C 11: 61,806,048 (GRCm39) S227G probably benign Het
Angptl8 T C 9: 21,747,112 (GRCm39) probably null Het
Arsi T C 18: 61,049,539 (GRCm39) S141P possibly damaging Het
Atic T A 1: 71,608,216 (GRCm39) Y303* probably null Het
Bbs9 C T 9: 22,557,359 (GRCm39) P510L probably benign Het
Bcl2a1b A G 9: 89,081,795 (GRCm39) N128S probably benign Het
Bcl2a1d A T 9: 88,613,549 (GRCm39) M75K probably damaging Het
Carm1 T A 9: 21,494,836 (GRCm39) L324Q probably damaging Het
Caskin1 T A 17: 24,722,782 (GRCm39) L550Q probably damaging Het
Cd302 A G 2: 60,087,412 (GRCm39) I142T probably benign Het
Cep350 A T 1: 155,738,882 (GRCm39) D2320E probably benign Het
Cgnl1 A G 9: 71,632,461 (GRCm39) S297P probably damaging Het
Cr1l T A 1: 194,789,210 (GRCm39) Y398F probably benign Het
Ctsa A T 2: 164,676,813 (GRCm39) D145V probably benign Het
Ctsj C T 13: 61,148,388 (GRCm39) G303D probably damaging Het
Dnah17 T C 11: 118,016,800 (GRCm39) I250M probably benign Het
Doc2a C A 7: 126,447,919 (GRCm39) C54* probably null Het
Dpy19l2 T C 9: 24,492,544 (GRCm39) T685A probably damaging Het
Dtna T A 18: 23,728,535 (GRCm39) C243* probably null Het
Exoc3l4 A G 12: 111,388,690 (GRCm39) T60A possibly damaging Het
Exph5 C A 9: 53,286,225 (GRCm39) S1102* probably null Het
Fhl3 T C 4: 124,599,481 (GRCm39) Y19H probably damaging Het
Flt4 A G 11: 49,528,646 (GRCm39) E1012G possibly damaging Het
Flvcr2 A G 12: 85,829,777 (GRCm39) N262S probably benign Het
Gon4l G T 3: 88,766,350 (GRCm39) C463F probably damaging Het
H2-T10 A T 17: 36,428,631 (GRCm39) probably null Het
Heatr3 T C 8: 88,871,200 (GRCm39) C185R probably benign Het
Hectd1 A G 12: 51,792,317 (GRCm39) V2474A probably benign Het
Htr3a C T 9: 48,812,795 (GRCm39) E215K probably damaging Het
Ica1l T C 1: 60,045,451 (GRCm39) T271A probably benign Het
Klra2 A G 6: 131,220,864 (GRCm39) I66T probably benign Het
Niban1 A G 1: 151,565,365 (GRCm39) T232A probably benign Het
Nisch T A 14: 30,906,971 (GRCm39) probably benign Het
Nr4a1 G T 15: 101,169,618 (GRCm39) R296L probably damaging Het
Obscn T C 11: 59,022,472 (GRCm39) R758G possibly damaging Het
Or7g19 T A 9: 18,856,496 (GRCm39) I184N probably damaging Het
Or8b50 T C 9: 38,518,397 (GRCm39) V212A probably benign Het
Pcsk5 A T 19: 17,452,198 (GRCm39) C1102* probably null Het
Phip C T 9: 82,757,358 (GRCm39) A1605T probably benign Het
Pstpip2 T A 18: 77,942,564 (GRCm39) M105K possibly damaging Het
Qprt C T 7: 126,707,532 (GRCm39) V219I probably benign Het
Ralgapa2 A T 2: 146,195,112 (GRCm39) N1271K probably damaging Het
Reg3g A T 6: 78,444,475 (GRCm39) L106H probably damaging Het
Rhobtb1 G A 10: 69,106,254 (GRCm39) G273D probably benign Het
Rimbp2 T C 5: 128,861,952 (GRCm39) D771G probably damaging Het
Sos2 T C 12: 69,643,573 (GRCm39) I935V possibly damaging Het
Tcf12 A T 9: 71,763,792 (GRCm39) N397K probably damaging Het
Tgtp2 T C 11: 48,949,957 (GRCm39) Q205R probably benign Het
Tle5 T A 10: 81,400,712 (GRCm39) C89S possibly damaging Het
Tubb2b T C 13: 34,312,209 (GRCm39) N195D probably benign Het
Unc13b A G 4: 43,095,843 (GRCm39) T84A probably benign Het
Usb1 T A 8: 96,069,759 (GRCm39) F102L probably benign Het
Vmn2r61 A G 7: 41,949,529 (GRCm39) T650A possibly damaging Het
Zbtb41 A C 1: 139,350,923 (GRCm39) D12A probably benign Het
Zbtb41 G T 1: 139,350,925 (GRCm39) E13* probably null Het
Zfp821 C T 8: 110,447,872 (GRCm39) S71F probably damaging Het
Other mutations in Neto2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01705:Neto2 APN 8 86,367,632 (GRCm39) missense probably damaging 1.00
IGL01938:Neto2 APN 8 86,417,484 (GRCm39) missense probably benign 0.00
IGL02238:Neto2 APN 8 86,396,292 (GRCm39) missense probably damaging 0.99
IGL02605:Neto2 APN 8 86,390,064 (GRCm39) splice site probably benign
IGL02813:Neto2 APN 8 86,417,515 (GRCm39) missense probably benign
R0138:Neto2 UTSW 8 86,367,673 (GRCm39) missense possibly damaging 0.72
R1934:Neto2 UTSW 8 86,397,033 (GRCm39) missense possibly damaging 0.96
R2423:Neto2 UTSW 8 86,396,396 (GRCm39) missense probably damaging 1.00
R3821:Neto2 UTSW 8 86,389,924 (GRCm39) nonsense probably null
R3822:Neto2 UTSW 8 86,389,924 (GRCm39) nonsense probably null
R3883:Neto2 UTSW 8 86,389,894 (GRCm39) missense probably damaging 1.00
R3939:Neto2 UTSW 8 86,400,747 (GRCm39) missense probably damaging 0.99
R3940:Neto2 UTSW 8 86,400,747 (GRCm39) missense probably damaging 0.99
R3941:Neto2 UTSW 8 86,400,747 (GRCm39) missense probably damaging 0.99
R4433:Neto2 UTSW 8 86,367,712 (GRCm39) missense probably damaging 1.00
R4668:Neto2 UTSW 8 86,367,691 (GRCm39) missense probably damaging 1.00
R4675:Neto2 UTSW 8 86,396,333 (GRCm39) missense probably damaging 1.00
R4908:Neto2 UTSW 8 86,396,393 (GRCm39) missense probably damaging 0.99
R5459:Neto2 UTSW 8 86,397,112 (GRCm39) missense probably benign 0.35
R5471:Neto2 UTSW 8 86,367,389 (GRCm39) missense probably benign 0.41
R5544:Neto2 UTSW 8 86,374,506 (GRCm39) missense possibly damaging 0.94
R5571:Neto2 UTSW 8 86,367,173 (GRCm39) missense probably damaging 1.00
R6083:Neto2 UTSW 8 86,367,214 (GRCm39) missense probably benign 0.00
R6339:Neto2 UTSW 8 86,367,187 (GRCm39) missense probably benign 0.33
R6381:Neto2 UTSW 8 86,369,138 (GRCm39) missense probably damaging 0.99
R6572:Neto2 UTSW 8 86,397,033 (GRCm39) missense possibly damaging 0.96
R6593:Neto2 UTSW 8 86,396,175 (GRCm39) missense probably damaging 1.00
R6662:Neto2 UTSW 8 86,389,844 (GRCm39) missense probably damaging 1.00
R6881:Neto2 UTSW 8 86,367,185 (GRCm39) missense probably damaging 1.00
R6950:Neto2 UTSW 8 86,397,072 (GRCm39) missense probably damaging 1.00
R7121:Neto2 UTSW 8 86,397,020 (GRCm39) splice site probably null
R7754:Neto2 UTSW 8 86,396,329 (GRCm39) missense probably damaging 0.98
R7755:Neto2 UTSW 8 86,396,285 (GRCm39) missense probably damaging 1.00
R8682:Neto2 UTSW 8 86,367,295 (GRCm39) missense probably benign 0.01
R9326:Neto2 UTSW 8 86,369,063 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGATTTTGTCAAGATCTGATAGC -3'
(R):5'- GGTCATAACCATTCAGCAATATCTGG -3'

Sequencing Primer
(F):5'- TTTGTCAAGATCTGATAGCTATCAAC -3'
(R):5'- AGTTGGACCTGCCCACAAGATG -3'
Posted On 2014-11-11