Incidental Mutation 'R2402:Carm1'
ID248754
Institutional Source Beutler Lab
Gene Symbol Carm1
Ensembl Gene ENSMUSG00000032185
Gene Namecoactivator-associated arginine methyltransferase 1
SynonymsPrmt4
MMRRC Submission 040368-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2402 (G1)
Quality Score187
Status Not validated
Chromosome9
Chromosomal Location21546894-21592623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21583540 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 324 (L324Q)
Ref Sequence ENSEMBL: ENSMUSP00000111053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034703] [ENSMUST00000115394] [ENSMUST00000115395] [ENSMUST00000130032]
Predicted Effect probably damaging
Transcript: ENSMUST00000034703
AA Change: L324Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034703
Gene: ENSMUSG00000032185
AA Change: L324Q

DomainStartEndE-ValueType
Pfam:CARM1 27 140 2.1e-71 PFAM
Pfam:PRMT5 144 447 2.3e-16 PFAM
Pfam:MTS 166 308 2.7e-10 PFAM
Pfam:Methyltransf_9 168 318 1.1e-9 PFAM
Pfam:PrmA 173 287 2.2e-12 PFAM
Pfam:Methyltransf_31 183 325 7.4e-11 PFAM
Pfam:Methyltransf_18 185 290 5.1e-12 PFAM
Pfam:Methyltransf_26 186 287 5.3e-10 PFAM
Pfam:Methyltransf_11 190 287 8.5e-7 PFAM
low complexity region 477 494 N/A INTRINSIC
low complexity region 562 576 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115394
AA Change: L324Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111052
Gene: ENSMUSG00000032185
AA Change: L324Q

DomainStartEndE-ValueType
Pfam:CARM1 29 140 4.7e-63 PFAM
Pfam:PRMT5 145 447 4.1e-16 PFAM
Pfam:Methyltransf_9 168 318 1.4e-9 PFAM
Pfam:MTS 170 299 2.5e-9 PFAM
Pfam:PrmA 175 287 3.7e-12 PFAM
Pfam:Methyltransf_31 183 326 1.9e-10 PFAM
Pfam:Methyltransf_18 185 290 4e-9 PFAM
Pfam:Methyltransf_11 190 287 6.5e-7 PFAM
low complexity region 477 494 N/A INTRINSIC
low complexity region 606 619 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115395
AA Change: L324Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111053
Gene: ENSMUSG00000032185
AA Change: L324Q

DomainStartEndE-ValueType
Pfam:CARM1 27 140 2e-71 PFAM
Pfam:PRMT5 144 447 2.1e-16 PFAM
Pfam:MTS 166 308 2.6e-10 PFAM
Pfam:Methyltransf_9 168 318 1.1e-9 PFAM
Pfam:PrmA 172 287 2.1e-12 PFAM
Pfam:Methyltransf_31 183 326 6.9e-11 PFAM
Pfam:Methyltransf_18 185 290 4.8e-12 PFAM
Pfam:Methyltransf_26 186 287 5e-10 PFAM
Pfam:Methyltransf_11 190 287 8.1e-7 PFAM
low complexity region 477 494 N/A INTRINSIC
low complexity region 540 553 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130032
SMART Domains Protein: ENSMUSP00000117243
Gene: ENSMUSG00000032185

DomainStartEndE-ValueType
Pfam:CARM1 27 140 2.8e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130100
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132011
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139871
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147749
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154049
Predicted Effect probably benign
Transcript: ENSMUST00000216160
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protein arginine methyltransferase (PRMT) family. The encoded enzyme catalyzes the methylation of guanidino nitrogens of arginyl residues of proteins. The enzyme acts specifically on histones and other chromatin-associated proteins and is involved in regulation of gene expression. The enzyme may act in association with other proteins or within multi-protein complexes and may play a role in cell type-specific functions and cell lineage specification. A related pseudogene is located on chromosome 9. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null fetuses are small and die perinatally, whereas heterozygotes are born at the expected Mendelian ratio but show decreased survival through weaning. Mice homozygous for a kinase null allele exhibit neonatal lethality, arrested T cell development, and impaired adipogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T A 8: 86,509,141 D1199V probably damaging Het
Abcc6 A T 7: 46,015,575 S277R probably benign Het
Acvrl1 A G 15: 101,137,399 S269G probably damaging Het
Aes T A 10: 81,564,878 C89S possibly damaging Het
Akap10 T C 11: 61,915,222 S227G probably benign Het
Angptl8 T C 9: 21,835,816 probably null Het
Arsi T C 18: 60,916,467 S141P possibly damaging Het
Atic T A 1: 71,569,057 Y303* probably null Het
Bbs9 C T 9: 22,646,063 P510L probably benign Het
Bcl2a1b A G 9: 89,199,742 N128S probably benign Het
Bcl2a1d A T 9: 88,731,496 M75K probably damaging Het
Caskin1 T A 17: 24,503,808 L550Q probably damaging Het
Cd302 A G 2: 60,257,068 I142T probably benign Het
Cep350 A T 1: 155,863,136 D2320E probably benign Het
Cgnl1 A G 9: 71,725,179 S297P probably damaging Het
Cr1l T A 1: 195,106,902 Y398F probably benign Het
Ctsa A T 2: 164,834,893 D145V probably benign Het
Ctsj C T 13: 61,000,574 G303D probably damaging Het
Dnah17 T C 11: 118,125,974 I250M probably benign Het
Doc2a C A 7: 126,848,747 C54* probably null Het
Dpy19l2 T C 9: 24,581,248 T685A probably damaging Het
Dtna T A 18: 23,595,478 C243* probably null Het
Exoc3l4 A G 12: 111,422,256 T60A possibly damaging Het
Exph5 C A 9: 53,374,925 S1102* probably null Het
Fam129a A G 1: 151,689,614 T232A probably benign Het
Fhl3 T C 4: 124,705,688 Y19H probably damaging Het
Flt4 A G 11: 49,637,819 E1012G possibly damaging Het
Flvcr2 A G 12: 85,783,003 N262S probably benign Het
Gon4l G T 3: 88,859,043 C463F probably damaging Het
H2-T10 A T 17: 36,117,739 probably null Het
Heatr3 T C 8: 88,144,572 C185R probably benign Het
Hectd1 A G 12: 51,745,534 V2474A probably benign Het
Htr3a C T 9: 48,901,495 E215K probably damaging Het
Ica1l T C 1: 60,006,292 T271A probably benign Het
Klra2 A G 6: 131,243,901 I66T probably benign Het
Neto2 T C 8: 85,690,912 K21R probably benign Het
Nisch T A 14: 31,185,014 probably benign Het
Nr4a1 G T 15: 101,271,737 R296L probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr832 T A 9: 18,945,200 I184N probably damaging Het
Olfr914 T C 9: 38,607,101 V212A probably benign Het
Pcsk5 A T 19: 17,474,834 C1102* probably null Het
Phip C T 9: 82,875,305 A1605T probably benign Het
Pstpip2 T A 18: 77,854,864 M105K possibly damaging Het
Qprt C T 7: 127,108,360 V219I probably benign Het
Ralgapa2 A T 2: 146,353,192 N1271K probably damaging Het
Reg3g A T 6: 78,467,492 L106H probably damaging Het
Rhobtb1 G A 10: 69,270,424 G273D probably benign Het
Rimbp2 T C 5: 128,784,888 D771G probably damaging Het
Sos2 T C 12: 69,596,799 I935V possibly damaging Het
Tcf12 A T 9: 71,856,510 N397K probably damaging Het
Tgtp2 T C 11: 49,059,130 Q205R probably benign Het
Tubb2b T C 13: 34,128,226 N195D probably benign Het
Unc13b A G 4: 43,095,843 T84A probably benign Het
Usb1 T A 8: 95,343,131 F102L probably benign Het
Vmn2r61 A G 7: 42,300,105 T650A possibly damaging Het
Zbtb41 A C 1: 139,423,185 D12A probably benign Het
Zbtb41 G T 1: 139,423,187 E13* probably null Het
Zfp821 C T 8: 109,721,240 S71F probably damaging Het
Other mutations in Carm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Carm1 APN 9 21587194 missense possibly damaging 0.62
IGL01360:Carm1 APN 9 21587302 missense probably benign 0.19
IGL01401:Carm1 APN 9 21569582 critical splice donor site probably null
IGL02218:Carm1 APN 9 21569512 missense probably damaging 1.00
IGL02436:Carm1 APN 9 21579462 missense probably damaging 1.00
IGL02601:Carm1 APN 9 21586908 missense probably damaging 1.00
R0551:Carm1 UTSW 9 21580491 splice site probably null
R0580:Carm1 UTSW 9 21583584 missense probably damaging 1.00
R0724:Carm1 UTSW 9 21587374 missense probably damaging 1.00
R0883:Carm1 UTSW 9 21569591 splice site probably benign
R1390:Carm1 UTSW 9 21579493 missense probably damaging 1.00
R1713:Carm1 UTSW 9 21586489 missense probably damaging 0.97
R1950:Carm1 UTSW 9 21574516 missense probably benign 0.01
R1960:Carm1 UTSW 9 21580310 missense probably benign 0.40
R2512:Carm1 UTSW 9 21575412 critical splice acceptor site probably null
R2520:Carm1 UTSW 9 21583597 splice site probably null
R2939:Carm1 UTSW 9 21579396 splice site probably null
R2940:Carm1 UTSW 9 21579396 splice site probably null
R3081:Carm1 UTSW 9 21579396 splice site probably null
R3407:Carm1 UTSW 9 21586182 missense probably damaging 1.00
R3434:Carm1 UTSW 9 21569473 missense probably damaging 1.00
R3808:Carm1 UTSW 9 21586962 missense probably damaging 1.00
R4504:Carm1 UTSW 9 21569526 missense probably damaging 1.00
R4700:Carm1 UTSW 9 21587184 missense probably benign 0.12
R5019:Carm1 UTSW 9 21579511 critical splice donor site probably null
R5362:Carm1 UTSW 9 21587359 missense probably benign 0.03
R5661:Carm1 UTSW 9 21586999 missense probably benign 0.10
R5730:Carm1 UTSW 9 21580340 missense probably benign 0.37
R5913:Carm1 UTSW 9 21587552 missense probably benign 0.01
R5928:Carm1 UTSW 9 21575302 intron probably benign
R6370:Carm1 UTSW 9 21587519 missense probably benign 0.11
R6431:Carm1 UTSW 9 21583077 missense probably damaging 1.00
R6555:Carm1 UTSW 9 21586962 missense probably damaging 1.00
R7177:Carm1 UTSW 9 21547027 missense unknown
R7235:Carm1 UTSW 9 21587405 critical splice donor site probably benign
R7249:Carm1 UTSW 9 21586209 missense probably benign
R7576:Carm1 UTSW 9 21586536 critical splice donor site probably null
R7650:Carm1 UTSW 9 21580372 missense probably benign 0.00
R7664:Carm1 UTSW 9 21586990 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATCTAAAGGACACGGGCTAGAC -3'
(R):5'- CATGTGCTTTGCAGAGTGAG -3'

Sequencing Primer
(F):5'- CTGGAATTCACTCTGTAGACCAGG -3'
(R):5'- GCTTTGCAGAGTGAGTGAGG -3'
Posted On2014-11-11