Incidental Mutation 'R2402:Bbs9'
ID248756
Institutional Source Beutler Lab
Gene Symbol Bbs9
Ensembl Gene ENSMUSG00000035919
Gene NameBardet-Biedl syndrome 9 (human)
SynonymsE130103I17Rik, EST 3159894
MMRRC Submission 040368-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.748) question?
Stock #R2402 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location22475715-22888280 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 22646063 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 510 (P510L)
Ref Sequence ENSEMBL: ENSMUSP00000116629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039798] [ENSMUST00000127296] [ENSMUST00000147405] [ENSMUST00000147712] [ENSMUST00000150395]
Predicted Effect probably benign
Transcript: ENSMUST00000039798
AA Change: P510L

PolyPhen 2 Score 0.230 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000043042
Gene: ENSMUSG00000035919
AA Change: P510L

DomainStartEndE-ValueType
Pfam:PHTB1_N 1 421 8e-168 PFAM
Pfam:PHTB1_C 439 814 8.3e-163 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127296
AA Change: P36L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect unknown
Transcript: ENSMUST00000136084
AA Change: P93L
SMART Domains Protein: ENSMUSP00000123160
Gene: ENSMUSG00000035919
AA Change: P93L

DomainStartEndE-ValueType
Pfam:PHTB1_C 24 162 2.9e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147405
AA Change: P510L

PolyPhen 2 Score 0.230 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000120927
Gene: ENSMUSG00000035919
AA Change: P510L

DomainStartEndE-ValueType
Pfam:PHTB1_N 1 417 1.1e-166 PFAM
Pfam:PHTB1_C 440 818 7e-158 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147712
AA Change: P510L

PolyPhen 2 Score 0.230 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000122058
Gene: ENSMUSG00000035919
AA Change: P510L

DomainStartEndE-ValueType
Pfam:PHTB1_N 1 421 8e-168 PFAM
Pfam:PHTB1_C 439 814 8.3e-163 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150395
AA Change: P510L

PolyPhen 2 Score 0.230 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000116629
Gene: ENSMUSG00000035919
AA Change: P510L

DomainStartEndE-ValueType
Pfam:PHTB1_N 1 421 8e-168 PFAM
Pfam:PHTB1_C 439 814 8.3e-163 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is downregulated by parathyroid hormone in osteoblastic cells, and therefore is thought to be involved in parathyroid hormone action in bones. The exact function of this gene has not yet been determined. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T A 8: 86,509,141 D1199V probably damaging Het
Abcc6 A T 7: 46,015,575 S277R probably benign Het
Acvrl1 A G 15: 101,137,399 S269G probably damaging Het
Aes T A 10: 81,564,878 C89S possibly damaging Het
Akap10 T C 11: 61,915,222 S227G probably benign Het
Angptl8 T C 9: 21,835,816 probably null Het
Arsi T C 18: 60,916,467 S141P possibly damaging Het
Atic T A 1: 71,569,057 Y303* probably null Het
Bcl2a1b A G 9: 89,199,742 N128S probably benign Het
Bcl2a1d A T 9: 88,731,496 M75K probably damaging Het
Carm1 T A 9: 21,583,540 L324Q probably damaging Het
Caskin1 T A 17: 24,503,808 L550Q probably damaging Het
Cd302 A G 2: 60,257,068 I142T probably benign Het
Cep350 A T 1: 155,863,136 D2320E probably benign Het
Cgnl1 A G 9: 71,725,179 S297P probably damaging Het
Cr1l T A 1: 195,106,902 Y398F probably benign Het
Ctsa A T 2: 164,834,893 D145V probably benign Het
Ctsj C T 13: 61,000,574 G303D probably damaging Het
Dnah17 T C 11: 118,125,974 I250M probably benign Het
Doc2a C A 7: 126,848,747 C54* probably null Het
Dpy19l2 T C 9: 24,581,248 T685A probably damaging Het
Dtna T A 18: 23,595,478 C243* probably null Het
Exoc3l4 A G 12: 111,422,256 T60A possibly damaging Het
Exph5 C A 9: 53,374,925 S1102* probably null Het
Fam129a A G 1: 151,689,614 T232A probably benign Het
Fhl3 T C 4: 124,705,688 Y19H probably damaging Het
Flt4 A G 11: 49,637,819 E1012G possibly damaging Het
Flvcr2 A G 12: 85,783,003 N262S probably benign Het
Gon4l G T 3: 88,859,043 C463F probably damaging Het
H2-T10 A T 17: 36,117,739 probably null Het
Heatr3 T C 8: 88,144,572 C185R probably benign Het
Hectd1 A G 12: 51,745,534 V2474A probably benign Het
Htr3a C T 9: 48,901,495 E215K probably damaging Het
Ica1l T C 1: 60,006,292 T271A probably benign Het
Klra2 A G 6: 131,243,901 I66T probably benign Het
Neto2 T C 8: 85,690,912 K21R probably benign Het
Nisch T A 14: 31,185,014 probably benign Het
Nr4a1 G T 15: 101,271,737 R296L probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr832 T A 9: 18,945,200 I184N probably damaging Het
Olfr914 T C 9: 38,607,101 V212A probably benign Het
Pcsk5 A T 19: 17,474,834 C1102* probably null Het
Phip C T 9: 82,875,305 A1605T probably benign Het
Pstpip2 T A 18: 77,854,864 M105K possibly damaging Het
Qprt C T 7: 127,108,360 V219I probably benign Het
Ralgapa2 A T 2: 146,353,192 N1271K probably damaging Het
Reg3g A T 6: 78,467,492 L106H probably damaging Het
Rhobtb1 G A 10: 69,270,424 G273D probably benign Het
Rimbp2 T C 5: 128,784,888 D771G probably damaging Het
Sos2 T C 12: 69,596,799 I935V possibly damaging Het
Tcf12 A T 9: 71,856,510 N397K probably damaging Het
Tgtp2 T C 11: 49,059,130 Q205R probably benign Het
Tubb2b T C 13: 34,128,226 N195D probably benign Het
Unc13b A G 4: 43,095,843 T84A probably benign Het
Usb1 T A 8: 95,343,131 F102L probably benign Het
Vmn2r61 A G 7: 42,300,105 T650A possibly damaging Het
Zbtb41 A C 1: 139,423,185 D12A probably benign Het
Zbtb41 G T 1: 139,423,187 E13* probably null Het
Zfp821 C T 8: 109,721,240 S71F probably damaging Het
Other mutations in Bbs9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01349:Bbs9 APN 9 22887683 missense probably benign 0.00
IGL01586:Bbs9 APN 9 22645997 missense possibly damaging 0.46
IGL01646:Bbs9 APN 9 22670925 nonsense probably null
IGL01654:Bbs9 APN 9 22490942 critical splice donor site probably null
IGL02172:Bbs9 APN 9 22579476 missense possibly damaging 0.65
IGL02212:Bbs9 APN 9 22812512 missense probably benign 0.02
IGL02444:Bbs9 APN 9 22643787 missense probably damaging 0.96
IGL02829:Bbs9 APN 9 22579484 missense probably damaging 0.98
IGL03385:Bbs9 APN 9 22643748 missense probably benign 0.19
corpulent UTSW 9 22575196 critical splice donor site probably null
Crapulence UTSW 9 22567764 missense probably damaging 1.00
R0038:Bbs9 UTSW 9 22504094 missense probably benign 0.30
R0243:Bbs9 UTSW 9 22514001 missense probably damaging 1.00
R0595:Bbs9 UTSW 9 22496815 missense probably benign
R0688:Bbs9 UTSW 9 22567719 missense probably damaging 0.98
R0726:Bbs9 UTSW 9 22793823 missense probably damaging 0.99
R0749:Bbs9 UTSW 9 22575201 splice site probably null
R0783:Bbs9 UTSW 9 22567714 missense possibly damaging 0.69
R1148:Bbs9 UTSW 9 22575100 splice site probably benign
R1532:Bbs9 UTSW 9 22887649 missense probably benign 0.00
R1783:Bbs9 UTSW 9 22659119 missense possibly damaging 0.85
R2285:Bbs9 UTSW 9 22678934 missense probably damaging 1.00
R2655:Bbs9 UTSW 9 22504052 missense probably damaging 1.00
R3428:Bbs9 UTSW 9 22567887 splice site probably benign
R3798:Bbs9 UTSW 9 22638769 missense probably damaging 1.00
R3806:Bbs9 UTSW 9 22887630 missense probably damaging 0.98
R4660:Bbs9 UTSW 9 22578767 missense probably benign 0.16
R4873:Bbs9 UTSW 9 22578715 missense probably benign 0.06
R4875:Bbs9 UTSW 9 22578715 missense probably benign 0.06
R5291:Bbs9 UTSW 9 22628997 missense probably damaging 1.00
R5364:Bbs9 UTSW 9 22575196 critical splice donor site probably null
R5502:Bbs9 UTSW 9 22504074 missense probably damaging 1.00
R5646:Bbs9 UTSW 9 22578715 missense probably benign 0.06
R5932:Bbs9 UTSW 9 22812331 missense probably damaging 1.00
R6222:Bbs9 UTSW 9 22567851 missense possibly damaging 0.88
R6451:Bbs9 UTSW 9 22567764 missense probably damaging 1.00
R6547:Bbs9 UTSW 9 22514069 missense probably benign 0.01
R6726:Bbs9 UTSW 9 22645964 missense probably benign 0.00
R6745:Bbs9 UTSW 9 22670836 missense probably benign 0.00
R6908:Bbs9 UTSW 9 22567723 missense probably damaging 0.96
R6919:Bbs9 UTSW 9 22812544 critical splice donor site probably null
R7102:Bbs9 UTSW 9 22579553 missense probably damaging 1.00
R7536:Bbs9 UTSW 9 22670800 missense probably damaging 1.00
R7712:Bbs9 UTSW 9 22670813 missense probably benign 0.34
X0027:Bbs9 UTSW 9 22655330 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGACCCAGGTAAAGAGATGC -3'
(R):5'- GGTATAGAGAAATACACCACACTTGC -3'

Sequencing Primer
(F):5'- GTGCTTACTGAAGTACCTGACACAG -3'
(R):5'- AGAAATACACCACACTTGCTATTAAG -3'
Posted On2014-11-11