Incidental Mutation 'R2402:Htr3a'
ID248759
Institutional Source Beutler Lab
Gene Symbol Htr3a
Ensembl Gene ENSMUSG00000032269
Gene Name5-hydroxytryptamine (serotonin) receptor 3A
Synonyms5-HT3 receptor
MMRRC Submission 040368-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2402 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location48899213-48911099 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 48901495 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 215 (E215K)
Ref Sequence ENSEMBL: ENSMUSP00000003826 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003826] [ENSMUST00000217289]
Predicted Effect probably damaging
Transcript: ENSMUST00000003826
AA Change: E215K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000003826
Gene: ENSMUSG00000032269
AA Change: E215K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 25 36 N/A INTRINSIC
Pfam:Neur_chan_LBD 40 247 4.7e-57 PFAM
Pfam:Neur_chan_memb 254 480 1.8e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216896
Predicted Effect probably damaging
Transcript: ENSMUST00000217289
AA Change: E215K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the ligand-gated ion channel receptor superfamily. This gene encodes subunit A of the type 3 receptor for 5-hydroxytryptamine (serotonin), a biogenic hormone that functions as a neurotransmitter, a hormone, and a mitogen. This receptor causes fast, depolarizing responses in neurons after activation. It appears that the heteromeric combination of A and B subunits is necessary to provide the full functional features of this receptor, since either subunit alone results in receptors with very low conductance and response amplitude. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice display a decreased lifespan, cachexia, increased blood urea nitrogen, proteinuria, kidney inflammation, and a hyperdistended and neurogenic urinary bladder. Mice homozygous for a second null mutation display reduced chemical pain persistence responses but are otherwise healthy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T A 8: 86,509,141 D1199V probably damaging Het
Abcc6 A T 7: 46,015,575 S277R probably benign Het
Acvrl1 A G 15: 101,137,399 S269G probably damaging Het
Aes T A 10: 81,564,878 C89S possibly damaging Het
Akap10 T C 11: 61,915,222 S227G probably benign Het
Angptl8 T C 9: 21,835,816 probably null Het
Arsi T C 18: 60,916,467 S141P possibly damaging Het
Atic T A 1: 71,569,057 Y303* probably null Het
Bbs9 C T 9: 22,646,063 P510L probably benign Het
Bcl2a1b A G 9: 89,199,742 N128S probably benign Het
Bcl2a1d A T 9: 88,731,496 M75K probably damaging Het
Carm1 T A 9: 21,583,540 L324Q probably damaging Het
Caskin1 T A 17: 24,503,808 L550Q probably damaging Het
Cd302 A G 2: 60,257,068 I142T probably benign Het
Cep350 A T 1: 155,863,136 D2320E probably benign Het
Cgnl1 A G 9: 71,725,179 S297P probably damaging Het
Cr1l T A 1: 195,106,902 Y398F probably benign Het
Ctsa A T 2: 164,834,893 D145V probably benign Het
Ctsj C T 13: 61,000,574 G303D probably damaging Het
Dnah17 T C 11: 118,125,974 I250M probably benign Het
Doc2a C A 7: 126,848,747 C54* probably null Het
Dpy19l2 T C 9: 24,581,248 T685A probably damaging Het
Dtna T A 18: 23,595,478 C243* probably null Het
Exoc3l4 A G 12: 111,422,256 T60A possibly damaging Het
Exph5 C A 9: 53,374,925 S1102* probably null Het
Fam129a A G 1: 151,689,614 T232A probably benign Het
Fhl3 T C 4: 124,705,688 Y19H probably damaging Het
Flt4 A G 11: 49,637,819 E1012G possibly damaging Het
Flvcr2 A G 12: 85,783,003 N262S probably benign Het
Gon4l G T 3: 88,859,043 C463F probably damaging Het
H2-T10 A T 17: 36,117,739 probably null Het
Heatr3 T C 8: 88,144,572 C185R probably benign Het
Hectd1 A G 12: 51,745,534 V2474A probably benign Het
Ica1l T C 1: 60,006,292 T271A probably benign Het
Klra2 A G 6: 131,243,901 I66T probably benign Het
Neto2 T C 8: 85,690,912 K21R probably benign Het
Nisch T A 14: 31,185,014 probably benign Het
Nr4a1 G T 15: 101,271,737 R296L probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr832 T A 9: 18,945,200 I184N probably damaging Het
Olfr914 T C 9: 38,607,101 V212A probably benign Het
Pcsk5 A T 19: 17,474,834 C1102* probably null Het
Phip C T 9: 82,875,305 A1605T probably benign Het
Pstpip2 T A 18: 77,854,864 M105K possibly damaging Het
Qprt C T 7: 127,108,360 V219I probably benign Het
Ralgapa2 A T 2: 146,353,192 N1271K probably damaging Het
Reg3g A T 6: 78,467,492 L106H probably damaging Het
Rhobtb1 G A 10: 69,270,424 G273D probably benign Het
Rimbp2 T C 5: 128,784,888 D771G probably damaging Het
Sos2 T C 12: 69,596,799 I935V possibly damaging Het
Tcf12 A T 9: 71,856,510 N397K probably damaging Het
Tgtp2 T C 11: 49,059,130 Q205R probably benign Het
Tubb2b T C 13: 34,128,226 N195D probably benign Het
Unc13b A G 4: 43,095,843 T84A probably benign Het
Usb1 T A 8: 95,343,131 F102L probably benign Het
Vmn2r61 A G 7: 42,300,105 T650A possibly damaging Het
Zbtb41 A C 1: 139,423,185 D12A probably benign Het
Zbtb41 G T 1: 139,423,187 E13* probably null Het
Zfp821 C T 8: 109,721,240 S71F probably damaging Het
Other mutations in Htr3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02314:Htr3a APN 9 48904627 missense probably damaging 0.99
R0238:Htr3a UTSW 9 48906386 missense probably benign 0.06
R0238:Htr3a UTSW 9 48906386 missense probably benign 0.06
R0403:Htr3a UTSW 9 48908659 missense probably damaging 0.96
R0899:Htr3a UTSW 9 48901452 missense possibly damaging 0.78
R1749:Htr3a UTSW 9 48900933 missense probably damaging 1.00
R1903:Htr3a UTSW 9 48906381 missense probably damaging 1.00
R1942:Htr3a UTSW 9 48908611 missense probably damaging 1.00
R2218:Htr3a UTSW 9 48908611 missense probably damaging 1.00
R2394:Htr3a UTSW 9 48906343 missense probably benign 0.29
R3430:Htr3a UTSW 9 48907388 missense probably benign 0.35
R6042:Htr3a UTSW 9 48904699 missense probably damaging 0.99
R6395:Htr3a UTSW 9 48900571 missense probably benign 0.00
R6407:Htr3a UTSW 9 48901055 nonsense probably null
R7791:Htr3a UTSW 9 48901575 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TTGCATGGAATGTGTATGGACC -3'
(R):5'- GTCTAGAGATCTGACAACAGGGC -3'

Sequencing Primer
(F):5'- CATGGAATGTGTATGGACCTGGAG -3'
(R):5'- AGGGCCCCTCAGGTATTGTTC -3'
Posted On2014-11-11