Incidental Mutation 'R0302:Il1rap'
ID24876
Institutional Source Beutler Lab
Gene Symbol Il1rap
Ensembl Gene ENSMUSG00000022514
Gene Nameinterleukin 1 receptor accessory protein
SynonymsIL-1RAcP, 6430709H04Rik, IL-1R AcP
MMRRC Submission 038514-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0302 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location26581704-26730117 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26692794 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 196 (N196S)
Ref Sequence ENSEMBL: ENSMUSP00000133904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023156] [ENSMUST00000096129] [ENSMUST00000166294] [ENSMUST00000174171] [ENSMUST00000174202]
Predicted Effect probably benign
Transcript: ENSMUST00000023156
AA Change: N196S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000023156
Gene: ENSMUSG00000022514
AA Change: N196S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 32 132 1.21e-2 SMART
IG 145 232 4.04e0 SMART
IG 251 350 1.46e-5 SMART
low complexity region 368 381 N/A INTRINSIC
TIR 404 549 5.29e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096129
AA Change: N196S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000093843
Gene: ENSMUSG00000022514
AA Change: N196S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 32 132 1.21e-2 SMART
IG 145 232 4.04e0 SMART
IG 251 350 1.46e-5 SMART
low complexity region 368 381 N/A INTRINSIC
TIR 404 547 1.38e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166294
AA Change: N196S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000128100
Gene: ENSMUSG00000022514
AA Change: N196S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 32 132 1.21e-2 SMART
IG 145 232 4.04e0 SMART
IG 251 350 1.46e-5 SMART
low complexity region 368 381 N/A INTRINSIC
TIR 404 547 1.38e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174171
AA Change: N196S

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000133904
Gene: ENSMUSG00000022514
AA Change: N196S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 32 132 1.21e-2 SMART
IG 145 232 4.04e0 SMART
Blast:IG 251 312 1e-28 BLAST
low complexity region 316 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174202
AA Change: N196S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000134202
Gene: ENSMUSG00000022514
AA Change: N196S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 32 132 1.21e-2 SMART
IG 145 232 4.04e0 SMART
IG 251 350 1.46e-5 SMART
Meta Mutation Damage Score 0.01 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.1%
  • 20x: 89.5%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interleukin 1 induces synthesis of acute phase and proinflammatory proteins during infection, tissue damage, or stress, by forming a complex at the cell membrane with an interleukin 1 receptor and an accessory protein. This gene encodes the interleukin 1 receptor accessory protein. The protein is a necessary part of the interleukin 1 receptor complex which initiates signalling events that result in the activation of interleukin 1-responsive genes. Alternative splicing of this gene results in two transcript variants encoding two different isoforms, one membrane-bound and one soluble. The ratio of soluble to membrane-bound forms increases during acute-phase induction or stress. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and grossly normal but show no biological response to IL-1. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl2 T C 4: 126,317,392 E244G probably benign Het
Aldh1l2 G A 10: 83,520,365 P54S probably damaging Het
Ankdd1a G A 9: 65,509,642 probably benign Het
Ankra2 T A 13: 98,271,692 S216R probably damaging Het
Asah2 A T 19: 32,052,956 N105K probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Cacna1s A G 1: 136,100,604 Y893C probably benign Het
Capza2 G A 6: 17,648,524 R15H probably benign Het
Cbfa2t2 T C 2: 154,534,876 probably benign Het
Ccdc96 A T 5: 36,486,101 T484S possibly damaging Het
Cckar GCTTAGCCTCTTCT GCT 5: 53,700,299 probably null Het
Ccl4 T A 11: 83,663,454 probably benign Het
Cpt1b A G 15: 89,417,870 Y702H probably benign Het
Cr1l G A 1: 195,117,793 T153I probably damaging Het
Cyth2 C A 7: 45,810,585 E57* probably null Het
Daxx T A 17: 33,913,620 S575T probably damaging Het
Depdc5 T C 5: 32,904,546 probably benign Het
Dnah12 A G 14: 26,799,999 D1923G probably damaging Het
Dnah7b A G 1: 46,123,777 T428A probably benign Het
Dnm2 G T 9: 21,500,343 A619S probably benign Het
Enpp2 T C 15: 54,860,061 T639A probably benign Het
Epsti1 A T 14: 77,939,926 H182L probably damaging Het
Exoc3l C T 8: 105,293,543 R250Q probably benign Het
Ggn G T 7: 29,171,240 probably null Het
Ints6 T C 14: 62,709,512 T335A probably damaging Het
Itga1 G A 13: 115,012,318 probably benign Het
Kifc3 G T 8: 95,103,470 Q557K possibly damaging Het
Krt23 A G 11: 99,478,201 I422T probably benign Het
Lcn2 A G 2: 32,384,889 probably benign Het
Lonp2 A G 8: 86,637,991 T326A possibly damaging Het
Lrpprc T C 17: 84,740,078 I909V possibly damaging Het
Lrrc14 G T 15: 76,714,352 R396L probably benign Het
Lypd6 T G 2: 50,165,667 probably benign Het
Man2b1 A G 8: 85,093,016 N610S probably damaging Het
Map2 A T 1: 66,414,828 N959I probably benign Het
Mctp2 C T 7: 72,090,264 V793I possibly damaging Het
Med25 A C 7: 44,880,558 probably benign Het
Mfsd6 T C 1: 52,709,457 Y83C probably damaging Het
Mtbp A T 15: 55,625,424 M499L probably damaging Het
Mtmr10 A T 7: 64,297,497 K53N probably damaging Het
Nfat5 T C 8: 107,358,701 I542T probably damaging Het
Nr1h3 A G 2: 91,192,013 M90T probably damaging Het
Nsmce4a A G 7: 130,545,893 probably benign Het
Olfr1168 T A 2: 88,185,510 I211N possibly damaging Het
Oprl1 G A 2: 181,719,228 C318Y probably benign Het
Pbx3 A T 2: 34,224,560 S46T probably benign Het
Pign A T 1: 105,589,093 F575I possibly damaging Het
Ptpn13 G T 5: 103,565,225 S1738I probably benign Het
Rnf126 G T 10: 79,759,223 P269Q probably damaging Het
Ryr3 G A 2: 112,647,123 probably benign Het
Slc2a7 C T 4: 150,149,521 A31V probably damaging Het
Slc6a12 A G 6: 121,363,259 D487G probably damaging Het
Son G T 16: 91,656,144 G593V probably damaging Het
Spata31d1a T C 13: 59,703,150 N388S probably benign Het
Spg11 A T 2: 122,092,187 M927K possibly damaging Het
Taf13 A G 3: 108,571,722 M1V probably null Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Trio A G 15: 27,902,517 F286S probably damaging Het
Trpm2 A C 10: 77,943,990 probably benign Het
Ttc7b T C 12: 100,387,179 M390V possibly damaging Het
Vmn1r184 A T 7: 26,267,543 Q238L probably damaging Het
Zfp236 T C 18: 82,658,088 E368G probably damaging Het
Zfr2 G T 10: 81,251,336 probably benign Het
Other mutations in Il1rap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Il1rap APN 16 26722401 missense possibly damaging 0.77
IGL00976:Il1rap APN 16 26698839 missense probably benign 0.09
IGL01075:Il1rap APN 16 26680237 missense possibly damaging 0.94
IGL01665:Il1rap APN 16 26722713 missense probably damaging 1.00
IGL01962:Il1rap APN 16 26710568 nonsense probably null
IGL02101:Il1rap APN 16 26624182 missense possibly damaging 0.61
IGL02411:Il1rap APN 16 26710616 missense probably damaging 1.00
IGL03132:Il1rap APN 16 26680119 missense probably damaging 1.00
bacchus UTSW 16 26710632 critical splice donor site probably null
I1329:Il1rap UTSW 16 26692850 missense probably benign 0.07
LCD18:Il1rap UTSW 16 26631593 intron probably benign
PIT1430001:Il1rap UTSW 16 26710593 missense possibly damaging 0.53
R0454:Il1rap UTSW 16 26698875 missense probably damaging 1.00
R0481:Il1rap UTSW 16 26692835 missense probably damaging 1.00
R0612:Il1rap UTSW 16 26701105 missense possibly damaging 0.48
R0765:Il1rap UTSW 16 26710632 critical splice donor site probably null
R1552:Il1rap UTSW 16 26722434 missense possibly damaging 0.79
R1801:Il1rap UTSW 16 26698875 missense probably damaging 1.00
R1867:Il1rap UTSW 16 26722926 missense probably damaging 1.00
R1942:Il1rap UTSW 16 26722455 missense probably damaging 1.00
R1996:Il1rap UTSW 16 26722493 missense probably benign 0.06
R2118:Il1rap UTSW 16 26710565 missense probably damaging 1.00
R2122:Il1rap UTSW 16 26710565 missense probably damaging 1.00
R2124:Il1rap UTSW 16 26710565 missense probably damaging 1.00
R3104:Il1rap UTSW 16 26722752 missense probably benign 0.01
R3105:Il1rap UTSW 16 26722752 missense probably benign 0.01
R3106:Il1rap UTSW 16 26722752 missense probably benign 0.01
R3891:Il1rap UTSW 16 26676856 missense probably damaging 1.00
R4133:Il1rap UTSW 16 26722886 missense probably benign 0.34
R4409:Il1rap UTSW 16 26712265 splice site probably null
R4610:Il1rap UTSW 16 26714776 missense probably benign 0.11
R4755:Il1rap UTSW 16 26722782 missense probably benign 0.20
R4776:Il1rap UTSW 16 26692799 missense possibly damaging 0.57
R4793:Il1rap UTSW 16 26695234 missense probably benign 0.09
R4811:Il1rap UTSW 16 26701238 critical splice donor site probably null
R4834:Il1rap UTSW 16 26676935 missense probably damaging 1.00
R5119:Il1rap UTSW 16 26624199 missense probably benign 0.01
R5744:Il1rap UTSW 16 26680224 missense probably benign 0.01
R6108:Il1rap UTSW 16 26722707 missense probably damaging 1.00
R6149:Il1rap UTSW 16 26712219 missense probably damaging 1.00
R6233:Il1rap UTSW 16 26710506 missense probably benign 0.24
R6246:Il1rap UTSW 16 26714881 missense probably benign
R6249:Il1rap UTSW 16 26692848 missense possibly damaging 0.88
R6254:Il1rap UTSW 16 26695270 missense probably benign
R6748:Il1rap UTSW 16 26722356 missense probably benign 0.02
R7151:Il1rap UTSW 16 26712128 missense probably damaging 1.00
X0027:Il1rap UTSW 16 26701147 missense probably benign 0.20
X0028:Il1rap UTSW 16 26676964 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGATGCTTGACTTGGAGGTCATATC -3'
(R):5'- AGTTTACATGGACCTGCTTTTGGACTG -3'

Sequencing Primer
(F):5'- CAAAGAAATATCGTCCAGAGTCTTG -3'
(R):5'- GGGATAGTGCATGAATAAATTCTGC -3'
Posted On2013-04-16