Incidental Mutation 'R2402:Flvcr2'
ID248775
Institutional Source Beutler Lab
Gene Symbol Flvcr2
Ensembl Gene ENSMUSG00000034258
Gene Namefeline leukemia virus subgroup C cellular receptor 2
SynonymsMfsd7c, CCT
MMRRC Submission 040368-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.914) question?
Stock #R2402 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location85746539-85813585 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85783003 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 262 (N262S)
Ref Sequence ENSEMBL: ENSMUSP00000035569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040461]
Predicted Effect probably benign
Transcript: ENSMUST00000040461
AA Change: N262S

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000035569
Gene: ENSMUSG00000034258
AA Change: N262S

DomainStartEndE-ValueType
Pfam:MFS_1 113 477 1.7e-30 PFAM
transmembrane domain 488 510 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221585
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the major facilitator superfamily. The encoded transmembrane protein is a calcium transporter. Unlike the related protein feline leukemia virus subgroup C receptor 1, the protein encoded by this locus does not bind to feline leukemia virus subgroup C envelope protein. The encoded protein may play a role in development of brain vascular endothelial cells, as mutations at this locus have been associated with proliferative vasculopathy and hydranencephaly-hydrocephaly syndrome. Alternatively spliced transcript variants have been described.[provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T A 8: 86,509,141 D1199V probably damaging Het
Abcc6 A T 7: 46,015,575 S277R probably benign Het
Acvrl1 A G 15: 101,137,399 S269G probably damaging Het
Aes T A 10: 81,564,878 C89S possibly damaging Het
Akap10 T C 11: 61,915,222 S227G probably benign Het
Angptl8 T C 9: 21,835,816 probably null Het
Arsi T C 18: 60,916,467 S141P possibly damaging Het
Atic T A 1: 71,569,057 Y303* probably null Het
Bbs9 C T 9: 22,646,063 P510L probably benign Het
Bcl2a1b A G 9: 89,199,742 N128S probably benign Het
Bcl2a1d A T 9: 88,731,496 M75K probably damaging Het
Carm1 T A 9: 21,583,540 L324Q probably damaging Het
Caskin1 T A 17: 24,503,808 L550Q probably damaging Het
Cd302 A G 2: 60,257,068 I142T probably benign Het
Cep350 A T 1: 155,863,136 D2320E probably benign Het
Cgnl1 A G 9: 71,725,179 S297P probably damaging Het
Cr1l T A 1: 195,106,902 Y398F probably benign Het
Ctsa A T 2: 164,834,893 D145V probably benign Het
Ctsj C T 13: 61,000,574 G303D probably damaging Het
Dnah17 T C 11: 118,125,974 I250M probably benign Het
Doc2a C A 7: 126,848,747 C54* probably null Het
Dpy19l2 T C 9: 24,581,248 T685A probably damaging Het
Dtna T A 18: 23,595,478 C243* probably null Het
Exoc3l4 A G 12: 111,422,256 T60A possibly damaging Het
Exph5 C A 9: 53,374,925 S1102* probably null Het
Fam129a A G 1: 151,689,614 T232A probably benign Het
Fhl3 T C 4: 124,705,688 Y19H probably damaging Het
Flt4 A G 11: 49,637,819 E1012G possibly damaging Het
Gon4l G T 3: 88,859,043 C463F probably damaging Het
H2-T10 A T 17: 36,117,739 probably null Het
Heatr3 T C 8: 88,144,572 C185R probably benign Het
Hectd1 A G 12: 51,745,534 V2474A probably benign Het
Htr3a C T 9: 48,901,495 E215K probably damaging Het
Ica1l T C 1: 60,006,292 T271A probably benign Het
Klra2 A G 6: 131,243,901 I66T probably benign Het
Neto2 T C 8: 85,690,912 K21R probably benign Het
Nisch T A 14: 31,185,014 probably benign Het
Nr4a1 G T 15: 101,271,737 R296L probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr832 T A 9: 18,945,200 I184N probably damaging Het
Olfr914 T C 9: 38,607,101 V212A probably benign Het
Pcsk5 A T 19: 17,474,834 C1102* probably null Het
Phip C T 9: 82,875,305 A1605T probably benign Het
Pstpip2 T A 18: 77,854,864 M105K possibly damaging Het
Qprt C T 7: 127,108,360 V219I probably benign Het
Ralgapa2 A T 2: 146,353,192 N1271K probably damaging Het
Reg3g A T 6: 78,467,492 L106H probably damaging Het
Rhobtb1 G A 10: 69,270,424 G273D probably benign Het
Rimbp2 T C 5: 128,784,888 D771G probably damaging Het
Sos2 T C 12: 69,596,799 I935V possibly damaging Het
Tcf12 A T 9: 71,856,510 N397K probably damaging Het
Tgtp2 T C 11: 49,059,130 Q205R probably benign Het
Tubb2b T C 13: 34,128,226 N195D probably benign Het
Unc13b A G 4: 43,095,843 T84A probably benign Het
Usb1 T A 8: 95,343,131 F102L probably benign Het
Vmn2r61 A G 7: 42,300,105 T650A possibly damaging Het
Zbtb41 A C 1: 139,423,185 D12A probably benign Het
Zbtb41 G T 1: 139,423,187 E13* probably null Het
Zfp821 C T 8: 109,721,240 S71F probably damaging Het
Other mutations in Flvcr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:Flvcr2 APN 12 85747323 missense possibly damaging 0.91
IGL01461:Flvcr2 APN 12 85803131 splice site probably benign
IGL02191:Flvcr2 APN 12 85786192 nonsense probably null
IGL02643:Flvcr2 APN 12 85796223 missense possibly damaging 0.96
IGL02933:Flvcr2 APN 12 85803128 splice site probably benign
pulga UTSW 12 85747191 missense possibly damaging 0.94
R1792:Flvcr2 UTSW 12 85747155 nonsense probably null
R1840:Flvcr2 UTSW 12 85803221 missense possibly damaging 0.91
R4120:Flvcr2 UTSW 12 85786129 missense probably benign 0.31
R4900:Flvcr2 UTSW 12 85782982 missense probably damaging 0.98
R5417:Flvcr2 UTSW 12 85747191 missense probably damaging 0.97
R5559:Flvcr2 UTSW 12 85804407 missense probably benign 0.21
R5639:Flvcr2 UTSW 12 85747476 missense probably benign 0.03
R5891:Flvcr2 UTSW 12 85796228 missense possibly damaging 0.74
R6347:Flvcr2 UTSW 12 85747420 missense possibly damaging 0.66
R6349:Flvcr2 UTSW 12 85747200 missense probably benign 0.30
R7082:Flvcr2 UTSW 12 85746954 missense probably benign 0.03
R7179:Flvcr2 UTSW 12 85747191 missense possibly damaging 0.94
R7241:Flvcr2 UTSW 12 85805239 missense probably benign
R7459:Flvcr2 UTSW 12 85747057 missense probably benign 0.14
R8030:Flvcr2 UTSW 12 85798538 missense probably damaging 0.97
R8384:Flvcr2 UTSW 12 85796193 missense possibly damaging 0.95
RF013:Flvcr2 UTSW 12 85747186 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGTGTGTATAGCATGTACATGTGC -3'
(R):5'- ATGTTCAAAGGGTGCCACCAG -3'

Sequencing Primer
(F):5'- TCCTTCCAATGCTGGGATGACAG -3'
(R):5'- GTGCCACCAGGGTTGACATAAC -3'
Posted On2014-11-11