Incidental Mutation 'R2402:Nr4a1'
ID248782
Institutional Source Beutler Lab
Gene Symbol Nr4a1
Ensembl Gene ENSMUSG00000023034
Gene Namenuclear receptor subfamily 4, group A, member 1
SynonymsTR3, Hbr1, Hmr, Gfrp, Hbr-1, NP10, GFRP1, NGFI-B, TIS1, Nur77, N10
MMRRC Submission 040368-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2402 (G1)
Quality Score221
Status Not validated
Chromosome15
Chromosomal Location101254269-101274795 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 101271737 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 296 (R296L)
Ref Sequence ENSEMBL: ENSMUSP00000155225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023779] [ENSMUST00000228985] [ENSMUST00000230814]
Predicted Effect probably damaging
Transcript: ENSMUST00000023779
AA Change: R296L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023779
Gene: ENSMUSG00000023034
AA Change: R296L

DomainStartEndE-ValueType
low complexity region 37 52 N/A INTRINSIC
low complexity region 77 102 N/A INTRINSIC
low complexity region 183 204 N/A INTRINSIC
ZnF_C4 267 338 1.93e-37 SMART
HOLI 411 569 3.77e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000228985
AA Change: R296L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000230814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231153
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the steroid-thyroid hormone-retinoid receptor superfamily. Expression is induced by phytohemagglutinin in human lymphocytes and by serum stimulation of arrested fibroblasts. The encoded protein acts as a nuclear transcription factor. Translocation of the protein from the nucleus to mitochondria induces apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile, and display a normal HPA axis function, as well as normal thymic and peripheral T cell deletion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T A 8: 86,509,141 D1199V probably damaging Het
Abcc6 A T 7: 46,015,575 S277R probably benign Het
Acvrl1 A G 15: 101,137,399 S269G probably damaging Het
Aes T A 10: 81,564,878 C89S possibly damaging Het
Akap10 T C 11: 61,915,222 S227G probably benign Het
Angptl8 T C 9: 21,835,816 probably null Het
Arsi T C 18: 60,916,467 S141P possibly damaging Het
Atic T A 1: 71,569,057 Y303* probably null Het
Bbs9 C T 9: 22,646,063 P510L probably benign Het
Bcl2a1b A G 9: 89,199,742 N128S probably benign Het
Bcl2a1d A T 9: 88,731,496 M75K probably damaging Het
Carm1 T A 9: 21,583,540 L324Q probably damaging Het
Caskin1 T A 17: 24,503,808 L550Q probably damaging Het
Cd302 A G 2: 60,257,068 I142T probably benign Het
Cep350 A T 1: 155,863,136 D2320E probably benign Het
Cgnl1 A G 9: 71,725,179 S297P probably damaging Het
Cr1l T A 1: 195,106,902 Y398F probably benign Het
Ctsa A T 2: 164,834,893 D145V probably benign Het
Ctsj C T 13: 61,000,574 G303D probably damaging Het
Dnah17 T C 11: 118,125,974 I250M probably benign Het
Doc2a C A 7: 126,848,747 C54* probably null Het
Dpy19l2 T C 9: 24,581,248 T685A probably damaging Het
Dtna T A 18: 23,595,478 C243* probably null Het
Exoc3l4 A G 12: 111,422,256 T60A possibly damaging Het
Exph5 C A 9: 53,374,925 S1102* probably null Het
Fam129a A G 1: 151,689,614 T232A probably benign Het
Fhl3 T C 4: 124,705,688 Y19H probably damaging Het
Flt4 A G 11: 49,637,819 E1012G possibly damaging Het
Flvcr2 A G 12: 85,783,003 N262S probably benign Het
Gon4l G T 3: 88,859,043 C463F probably damaging Het
H2-T10 A T 17: 36,117,739 probably null Het
Heatr3 T C 8: 88,144,572 C185R probably benign Het
Hectd1 A G 12: 51,745,534 V2474A probably benign Het
Htr3a C T 9: 48,901,495 E215K probably damaging Het
Ica1l T C 1: 60,006,292 T271A probably benign Het
Klra2 A G 6: 131,243,901 I66T probably benign Het
Neto2 T C 8: 85,690,912 K21R probably benign Het
Nisch T A 14: 31,185,014 probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr832 T A 9: 18,945,200 I184N probably damaging Het
Olfr914 T C 9: 38,607,101 V212A probably benign Het
Pcsk5 A T 19: 17,474,834 C1102* probably null Het
Phip C T 9: 82,875,305 A1605T probably benign Het
Pstpip2 T A 18: 77,854,864 M105K possibly damaging Het
Qprt C T 7: 127,108,360 V219I probably benign Het
Ralgapa2 A T 2: 146,353,192 N1271K probably damaging Het
Reg3g A T 6: 78,467,492 L106H probably damaging Het
Rhobtb1 G A 10: 69,270,424 G273D probably benign Het
Rimbp2 T C 5: 128,784,888 D771G probably damaging Het
Sos2 T C 12: 69,596,799 I935V possibly damaging Het
Tcf12 A T 9: 71,856,510 N397K probably damaging Het
Tgtp2 T C 11: 49,059,130 Q205R probably benign Het
Tubb2b T C 13: 34,128,226 N195D probably benign Het
Unc13b A G 4: 43,095,843 T84A probably benign Het
Usb1 T A 8: 95,343,131 F102L probably benign Het
Vmn2r61 A G 7: 42,300,105 T650A possibly damaging Het
Zbtb41 A C 1: 139,423,185 D12A probably benign Het
Zbtb41 G T 1: 139,423,187 E13* probably null Het
Zfp821 C T 8: 109,721,240 S71F probably damaging Het
Other mutations in Nr4a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Nr4a1 APN 15 101270899 missense probably damaging 1.00
IGL00966:Nr4a1 APN 15 101272788 missense probably damaging 1.00
IGL01326:Nr4a1 APN 15 101274059 missense probably damaging 1.00
R0539:Nr4a1 UTSW 15 101270884 missense probably damaging 1.00
R1853:Nr4a1 UTSW 15 101271764 missense probably benign 0.00
R1854:Nr4a1 UTSW 15 101271764 missense probably benign 0.00
R1909:Nr4a1 UTSW 15 101274227 missense probably damaging 1.00
R2073:Nr4a1 UTSW 15 101274067 missense probably damaging 0.96
R2392:Nr4a1 UTSW 15 101274194 missense possibly damaging 0.70
R3001:Nr4a1 UTSW 15 101270972 splice site probably null
R3002:Nr4a1 UTSW 15 101270972 splice site probably null
R4190:Nr4a1 UTSW 15 101274112 missense probably damaging 1.00
R5218:Nr4a1 UTSW 15 101272153 missense probably benign 0.02
R6363:Nr4a1 UTSW 15 101274115 missense probably damaging 1.00
R7559:Nr4a1 UTSW 15 101270899 missense probably damaging 1.00
R7910:Nr4a1 UTSW 15 101271760 missense probably damaging 1.00
R8387:Nr4a1 UTSW 15 101273172 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAAACCTTCTCCAGTATCTCCCAG -3'
(R):5'- TAGGTGCAGATCCTGGTGAG -3'

Sequencing Primer
(F):5'- AGTATCTCCCAGACTCCTCTCTG -3'
(R):5'- GCTGTCCCACCCCATCAG -3'
Posted On2014-11-11