Mutagenetix > Incidental Mutations

Incidental Mutation 'R2402:Nr4a1'

248782

Institutional Source

Beutler Lab

Gene Symbol

Nr4a1

Ensembl Gene

ENSMUSG00000023034

Gene Name

nuclear receptor subfamily 4, group A, member 1

Synonyms

TR3, Hbr1, Hmr, Gfrp, Hbr-1, NP10, GFRP1, NGFI-B, TIS1, Nur77, N10

MMRRC Submission

040368-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2402 (G1)

Quality Score

221

Status

Not validated

Chromosome

Chromosomal Location

101254269-101274795 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 101271737 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 296 (R296L)

Ref Sequence

ENSEMBL: ENSMUSP00000155225 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023779] [ENSMUST00000228985] [ENSMUST00000230814]

AlphaFold

P12813

Predicted Effect

probably damaging
Transcript: ENSMUST00000023779
AA Change: R296L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000023779
Gene: ENSMUSG00000023034
AA Change: R296L

Domain	Start	End	E-Value	Type
low complexity region	37	52	N/A	INTRINSIC
low complexity region	77	102	N/A	INTRINSIC
low complexity region	183	204	N/A	INTRINSIC
ZnF_C4	267	338	1.93e-37	SMART
HOLI	411	569	3.77e-31	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000228985
AA Change: R296L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

Predicted Effect

probably benign
Transcript: ENSMUST00000230814

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231153

Coding Region Coverage

1x: 99.0%
3x: 98.3%
10x: 96.6%
20x: 92.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the steroid-thyroid hormone-retinoid receptor superfamily. Expression is induced by phytohemagglutinin in human lymphocytes and by serum stimulation of arrested fibroblasts. The encoded protein acts as a nuclear transcription factor. Translocation of the protein from the nucleus to mitochondria induces apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile, and display a normal HPA axis function, as well as normal thymic and peripheral T cell deletion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc12	T	A	8: 86,509,141	D1199V	probably damaging	Het
Abcc6	A	T	7: 46,015,575	S277R	probably benign	Het
Acvrl1	A	G	15: 101,137,399	S269G	probably damaging	Het
Aes	T	A	10: 81,564,878	C89S	possibly damaging	Het
Akap10	T	C	11: 61,915,222	S227G	probably benign	Het
Angptl8	T	C	9: 21,835,816		probably null	Het
Arsi	T	C	18: 60,916,467	S141P	possibly damaging	Het
Atic	T	A	1: 71,569,057	Y303*	probably null	Het
Bbs9	C	T	9: 22,646,063	P510L	probably benign	Het
Bcl2a1b	A	G	9: 89,199,742	N128S	probably benign	Het
Bcl2a1d	A	T	9: 88,731,496	M75K	probably damaging	Het
Carm1	T	A	9: 21,583,540	L324Q	probably damaging	Het
Caskin1	T	A	17: 24,503,808	L550Q	probably damaging	Het
Cd302	A	G	2: 60,257,068	I142T	probably benign	Het
Cep350	A	T	1: 155,863,136	D2320E	probably benign	Het
Cgnl1	A	G	9: 71,725,179	S297P	probably damaging	Het
Cr1l	T	A	1: 195,106,902	Y398F	probably benign	Het
Ctsa	A	T	2: 164,834,893	D145V	probably benign	Het
Ctsj	C	T	13: 61,000,574	G303D	probably damaging	Het
Dnah17	T	C	11: 118,125,974	I250M	probably benign	Het
Doc2a	C	A	7: 126,848,747	C54*	probably null	Het
Dpy19l2	T	C	9: 24,581,248	T685A	probably damaging	Het
Dtna	T	A	18: 23,595,478	C243*	probably null	Het
Exoc3l4	A	G	12: 111,422,256	T60A	possibly damaging	Het
Exph5	C	A	9: 53,374,925	S1102*	probably null	Het
Fam129a	A	G	1: 151,689,614	T232A	probably benign	Het
Fhl3	T	C	4: 124,705,688	Y19H	probably damaging	Het
Flt4	A	G	11: 49,637,819	E1012G	possibly damaging	Het
Flvcr2	A	G	12: 85,783,003	N262S	probably benign	Het
Gon4l	G	T	3: 88,859,043	C463F	probably damaging	Het
H2-T10	A	T	17: 36,117,739		probably null	Het
Heatr3	T	C	8: 88,144,572	C185R	probably benign	Het
Hectd1	A	G	12: 51,745,534	V2474A	probably benign	Het
Htr3a	C	T	9: 48,901,495	E215K	probably damaging	Het
Ica1l	T	C	1: 60,006,292	T271A	probably benign	Het
Klra2	A	G	6: 131,243,901	I66T	probably benign	Het
Neto2	T	C	8: 85,690,912	K21R	probably benign	Het
Nisch	T	A	14: 31,185,014		probably benign	Het
Obscn	T	C	11: 59,131,646	R758G	possibly damaging	Het
Olfr832	T	A	9: 18,945,200	I184N	probably damaging	Het
Olfr914	T	C	9: 38,607,101	V212A	probably benign	Het
Pcsk5	A	T	19: 17,474,834	C1102*	probably null	Het
Phip	C	T	9: 82,875,305	A1605T	probably benign	Het
Pstpip2	T	A	18: 77,854,864	M105K	possibly damaging	Het
Qprt	C	T	7: 127,108,360	V219I	probably benign	Het
Ralgapa2	A	T	2: 146,353,192	N1271K	probably damaging	Het
Reg3g	A	T	6: 78,467,492	L106H	probably damaging	Het
Rhobtb1	G	A	10: 69,270,424	G273D	probably benign	Het
Rimbp2	T	C	5: 128,784,888	D771G	probably damaging	Het
Sos2	T	C	12: 69,596,799	I935V	possibly damaging	Het
Tcf12	A	T	9: 71,856,510	N397K	probably damaging	Het
Tgtp2	T	C	11: 49,059,130	Q205R	probably benign	Het
Tubb2b	T	C	13: 34,128,226	N195D	probably benign	Het
Unc13b	A	G	4: 43,095,843	T84A	probably benign	Het
Usb1	T	A	8: 95,343,131	F102L	probably benign	Het
Vmn2r61	A	G	7: 42,300,105	T650A	possibly damaging	Het
Zbtb41	A	C	1: 139,423,185	D12A	probably benign	Het
Zbtb41	G	T	1: 139,423,187	E13*	probably null	Het
Zfp821	C	T	8: 109,721,240	S71F	probably damaging	Het

Other mutations in Nr4a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Nr4a1	APN	15	101270899	missense	probably damaging	1.00
IGL00966:Nr4a1	APN	15	101272788	missense	probably damaging	1.00
IGL01326:Nr4a1	APN	15	101274059	missense	probably damaging	1.00
R0539:Nr4a1	UTSW	15	101270884	missense	probably damaging	1.00
R1853:Nr4a1	UTSW	15	101271764	missense	probably benign	0.00
R1854:Nr4a1	UTSW	15	101271764	missense	probably benign	0.00
R1909:Nr4a1	UTSW	15	101274227	missense	probably damaging	1.00
R2073:Nr4a1	UTSW	15	101274067	missense	probably damaging	0.96
R2392:Nr4a1	UTSW	15	101274194	missense	possibly damaging	0.70
R3001:Nr4a1	UTSW	15	101270972	splice site	probably null
R3002:Nr4a1	UTSW	15	101270972	splice site	probably null
R4190:Nr4a1	UTSW	15	101274112	missense	probably damaging	1.00
R5218:Nr4a1	UTSW	15	101272153	missense	probably benign	0.02
R6363:Nr4a1	UTSW	15	101274115	missense	probably damaging	1.00
R7559:Nr4a1	UTSW	15	101270899	missense	probably damaging	1.00
R7910:Nr4a1	UTSW	15	101271760	missense	probably damaging	1.00
R8387:Nr4a1	UTSW	15	101273172	missense	probably damaging	0.98
R9428:Nr4a1	UTSW	15	101270364	missense	probably damaging	1.00
R9449:Nr4a1	UTSW	15	101270172	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GAAACCTTCTCCAGTATCTCCCAG -3'
(R):5'- TAGGTGCAGATCCTGGTGAG -3'

Sequencing Primer
(F):5'- AGTATCTCCCAGACTCCTCTCTG -3'
(R):5'- GCTGTCCCACCCCATCAG -3'

Posted On

2014-11-11