Incidental Mutation 'R2402:Dtna'
ID 248785
Institutional Source Beutler Lab
Gene Symbol Dtna
Ensembl Gene ENSMUSG00000024302
Gene Name dystrobrevin alpha
Synonyms a-DB-1, A0, alpha-dystrobrevin, 2210407P21Rik, 87K protein, Dtn, adbn
MMRRC Submission 040368-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.207) question?
Stock # R2402 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 23548192-23792772 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 23728535 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 243 (C243*)
Ref Sequence ENSEMBL: ENSMUSP00000152565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047954] [ENSMUST00000115832] [ENSMUST00000220904] [ENSMUST00000221880]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000047954
AA Change: C243*
SMART Domains Protein: ENSMUSP00000037475
Gene: ENSMUSG00000024302
AA Change: C243*

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 4.9e-43 PFAM
Pfam:EF-hand_3 144 232 7.8e-38 PFAM
ZnF_ZZ 237 282 1.29e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115832
AA Change: C243*
SMART Domains Protein: ENSMUSP00000111498
Gene: ENSMUSG00000024302
AA Change: C243*

DomainStartEndE-ValueType
Pfam:EF-hand_2 16 140 1.7e-37 PFAM
Pfam:EF-hand_3 144 232 1.6e-32 PFAM
ZnF_ZZ 237 282 1.29e-17 SMART
SCOP:d1eq1a_ 361 494 5e-3 SMART
low complexity region 499 514 N/A INTRINSIC
coiled coil region 650 677 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000220904
AA Change: C243*
Predicted Effect probably null
Transcript: ENSMUST00000221880
AA Change: C243*
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the dystrobrevin subfamily of the dystrophin family. This protein is a component of the dystrophin-associated protein complex (DPC), which consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and alpha- and beta-dystrobrevin. The DPC localizes to the sarcolemma and its disruption is associated with various forms of muscular dystrophy. Mutations in this gene are associated with left ventricular noncompaction with congenital heart defects. Multiple alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted mutants exhibit skeletal and cardiac myopathies. Neuromuscular junctions appear to form normally, but their postnatal maturation is compromised. Dtna mutations do not increase the severity of Dmd or Utrn mutants whose products are also part of the dystrophin-glycoprotein complex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T A 8: 87,235,770 (GRCm39) D1199V probably damaging Het
Abcc6 A T 7: 45,664,999 (GRCm39) S277R probably benign Het
Acvrl1 A G 15: 101,035,280 (GRCm39) S269G probably damaging Het
Akap10 T C 11: 61,806,048 (GRCm39) S227G probably benign Het
Angptl8 T C 9: 21,747,112 (GRCm39) probably null Het
Arsi T C 18: 61,049,539 (GRCm39) S141P possibly damaging Het
Atic T A 1: 71,608,216 (GRCm39) Y303* probably null Het
Bbs9 C T 9: 22,557,359 (GRCm39) P510L probably benign Het
Bcl2a1b A G 9: 89,081,795 (GRCm39) N128S probably benign Het
Bcl2a1d A T 9: 88,613,549 (GRCm39) M75K probably damaging Het
Carm1 T A 9: 21,494,836 (GRCm39) L324Q probably damaging Het
Caskin1 T A 17: 24,722,782 (GRCm39) L550Q probably damaging Het
Cd302 A G 2: 60,087,412 (GRCm39) I142T probably benign Het
Cep350 A T 1: 155,738,882 (GRCm39) D2320E probably benign Het
Cgnl1 A G 9: 71,632,461 (GRCm39) S297P probably damaging Het
Cr1l T A 1: 194,789,210 (GRCm39) Y398F probably benign Het
Ctsa A T 2: 164,676,813 (GRCm39) D145V probably benign Het
Ctsj C T 13: 61,148,388 (GRCm39) G303D probably damaging Het
Dnah17 T C 11: 118,016,800 (GRCm39) I250M probably benign Het
Doc2a C A 7: 126,447,919 (GRCm39) C54* probably null Het
Dpy19l2 T C 9: 24,492,544 (GRCm39) T685A probably damaging Het
Exoc3l4 A G 12: 111,388,690 (GRCm39) T60A possibly damaging Het
Exph5 C A 9: 53,286,225 (GRCm39) S1102* probably null Het
Fhl3 T C 4: 124,599,481 (GRCm39) Y19H probably damaging Het
Flt4 A G 11: 49,528,646 (GRCm39) E1012G possibly damaging Het
Flvcr2 A G 12: 85,829,777 (GRCm39) N262S probably benign Het
Gon4l G T 3: 88,766,350 (GRCm39) C463F probably damaging Het
H2-T10 A T 17: 36,428,631 (GRCm39) probably null Het
Heatr3 T C 8: 88,871,200 (GRCm39) C185R probably benign Het
Hectd1 A G 12: 51,792,317 (GRCm39) V2474A probably benign Het
Htr3a C T 9: 48,812,795 (GRCm39) E215K probably damaging Het
Ica1l T C 1: 60,045,451 (GRCm39) T271A probably benign Het
Klra2 A G 6: 131,220,864 (GRCm39) I66T probably benign Het
Neto2 T C 8: 86,417,541 (GRCm39) K21R probably benign Het
Niban1 A G 1: 151,565,365 (GRCm39) T232A probably benign Het
Nisch T A 14: 30,906,971 (GRCm39) probably benign Het
Nr4a1 G T 15: 101,169,618 (GRCm39) R296L probably damaging Het
Obscn T C 11: 59,022,472 (GRCm39) R758G possibly damaging Het
Or7g19 T A 9: 18,856,496 (GRCm39) I184N probably damaging Het
Or8b50 T C 9: 38,518,397 (GRCm39) V212A probably benign Het
Pcsk5 A T 19: 17,452,198 (GRCm39) C1102* probably null Het
Phip C T 9: 82,757,358 (GRCm39) A1605T probably benign Het
Pstpip2 T A 18: 77,942,564 (GRCm39) M105K possibly damaging Het
Qprt C T 7: 126,707,532 (GRCm39) V219I probably benign Het
Ralgapa2 A T 2: 146,195,112 (GRCm39) N1271K probably damaging Het
Reg3g A T 6: 78,444,475 (GRCm39) L106H probably damaging Het
Rhobtb1 G A 10: 69,106,254 (GRCm39) G273D probably benign Het
Rimbp2 T C 5: 128,861,952 (GRCm39) D771G probably damaging Het
Sos2 T C 12: 69,643,573 (GRCm39) I935V possibly damaging Het
Tcf12 A T 9: 71,763,792 (GRCm39) N397K probably damaging Het
Tgtp2 T C 11: 48,949,957 (GRCm39) Q205R probably benign Het
Tle5 T A 10: 81,400,712 (GRCm39) C89S possibly damaging Het
Tubb2b T C 13: 34,312,209 (GRCm39) N195D probably benign Het
Unc13b A G 4: 43,095,843 (GRCm39) T84A probably benign Het
Usb1 T A 8: 96,069,759 (GRCm39) F102L probably benign Het
Vmn2r61 A G 7: 41,949,529 (GRCm39) T650A possibly damaging Het
Zbtb41 A C 1: 139,350,923 (GRCm39) D12A probably benign Het
Zbtb41 G T 1: 139,350,925 (GRCm39) E13* probably null Het
Zfp821 C T 8: 110,447,872 (GRCm39) S71F probably damaging Het
Other mutations in Dtna
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Dtna APN 18 23,730,545 (GRCm39) missense probably benign 0.22
IGL01620:Dtna APN 18 23,758,144 (GRCm39) missense probably damaging 1.00
IGL01705:Dtna APN 18 23,678,788 (GRCm39) missense probably damaging 1.00
IGL01914:Dtna APN 18 23,730,516 (GRCm39) missense possibly damaging 0.62
IGL02388:Dtna APN 18 23,730,571 (GRCm39) missense probably benign 0.00
IGL02427:Dtna APN 18 23,784,595 (GRCm39) missense possibly damaging 0.95
IGL03074:Dtna APN 18 23,735,662 (GRCm39) missense possibly damaging 0.74
R0041:Dtna UTSW 18 23,779,932 (GRCm39) unclassified probably benign
R0041:Dtna UTSW 18 23,779,932 (GRCm39) unclassified probably benign
R0078:Dtna UTSW 18 23,754,499 (GRCm39) missense probably damaging 1.00
R0390:Dtna UTSW 18 23,730,558 (GRCm39) missense probably damaging 1.00
R1808:Dtna UTSW 18 23,702,697 (GRCm39) missense probably damaging 1.00
R1872:Dtna UTSW 18 23,730,617 (GRCm39) critical splice donor site probably null
R2095:Dtna UTSW 18 23,702,805 (GRCm39) missense probably damaging 1.00
R2216:Dtna UTSW 18 23,702,622 (GRCm39) missense probably damaging 1.00
R2295:Dtna UTSW 18 23,764,469 (GRCm39) missense probably damaging 1.00
R2846:Dtna UTSW 18 23,784,560 (GRCm39) splice site probably null
R3836:Dtna UTSW 18 23,758,159 (GRCm39) missense probably damaging 1.00
R4764:Dtna UTSW 18 23,668,206 (GRCm39) splice site probably null
R4893:Dtna UTSW 18 23,702,724 (GRCm39) missense probably damaging 0.99
R5194:Dtna UTSW 18 23,723,302 (GRCm39) nonsense probably null
R5373:Dtna UTSW 18 23,784,670 (GRCm39) missense probably damaging 1.00
R5374:Dtna UTSW 18 23,784,670 (GRCm39) missense probably damaging 1.00
R5526:Dtna UTSW 18 23,779,287 (GRCm39) missense probably damaging 0.99
R5755:Dtna UTSW 18 23,754,520 (GRCm39) missense probably benign
R5769:Dtna UTSW 18 23,784,611 (GRCm39) missense probably benign 0.27
R6062:Dtna UTSW 18 23,755,113 (GRCm39) missense possibly damaging 0.87
R6413:Dtna UTSW 18 23,755,071 (GRCm39) missense probably damaging 1.00
R6876:Dtna UTSW 18 23,744,167 (GRCm39) missense probably benign 0.00
R7103:Dtna UTSW 18 23,786,436 (GRCm39) critical splice donor site probably null
R7711:Dtna UTSW 18 23,758,253 (GRCm39) critical splice donor site probably null
R7804:Dtna UTSW 18 23,728,666 (GRCm39) missense probably damaging 0.97
R8156:Dtna UTSW 18 23,723,388 (GRCm39) nonsense probably null
R8437:Dtna UTSW 18 23,723,398 (GRCm39) nonsense probably null
R8786:Dtna UTSW 18 23,716,190 (GRCm39) missense probably benign 0.10
R9038:Dtna UTSW 18 23,743,553 (GRCm39) missense probably benign
R9268:Dtna UTSW 18 23,702,643 (GRCm39) missense possibly damaging 0.93
R9416:Dtna UTSW 18 23,780,112 (GRCm39) critical splice donor site probably null
R9578:Dtna UTSW 18 23,728,612 (GRCm39) missense probably damaging 0.98
R9605:Dtna UTSW 18 23,764,454 (GRCm39) missense probably damaging 1.00
R9638:Dtna UTSW 18 23,744,122 (GRCm39) missense probably benign
X0063:Dtna UTSW 18 23,776,225 (GRCm39) missense probably damaging 0.98
X0066:Dtna UTSW 18 23,726,038 (GRCm39) missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- ACAGTATGTTGCCAGAGGAC -3'
(R):5'- AAACACTGCCTGGCCTTCAC -3'

Sequencing Primer
(F):5'- GCCAGAGGACATTTATTTCTCATC -3'
(R):5'- TTCACTTACCCACGACGTATAC -3'
Posted On 2014-11-11