Incidental Mutation 'R2403:Olfr361'
ID248795
Institutional Source Beutler Lab
Gene Symbol Olfr361
Ensembl Gene ENSMUSG00000075378
Gene Nameolfactory receptor 361
SynonymsGA_x6K02T2NLDC-33777519-33776551, MOR159-3
MMRRC Submission 040369-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R2403 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location37083736-37089290 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37084974 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 258 (Y258C)
Ref Sequence ENSEMBL: ENSMUSP00000149770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100145] [ENSMUST00000214969] [ENSMUST00000216663]
Predicted Effect probably benign
Transcript: ENSMUST00000100145
AA Change: Y258C

PolyPhen 2 Score 0.345 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097723
Gene: ENSMUSG00000075378
AA Change: Y258C

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.5e-44 PFAM
Pfam:7tm_1 41 289 2.3e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126779
Predicted Effect probably benign
Transcript: ENSMUST00000214969
AA Change: Y258C

PolyPhen 2 Score 0.345 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000216663
AA Change: Y258C

PolyPhen 2 Score 0.345 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,170,943 E925G probably damaging Het
Abca9 T G 11: 110,115,454 Q1275P probably benign Het
Adgrl1 T A 8: 83,931,241 M492K probably benign Het
Ankrd50 T A 3: 38,483,085 K3* probably null Het
Arl5b T C 2: 15,075,037 S140P probably damaging Het
Armc1 T C 3: 19,157,676 probably benign Het
Ascc1 T C 10: 60,004,841 I8T probably benign Het
Bche A G 3: 73,701,472 V207A probably damaging Het
Cacna2d3 A G 14: 28,905,302 L1080P probably benign Het
Ceacam3 C A 7: 17,161,854 A583D probably damaging Het
Cep290 C T 10: 100,537,437 A1193V probably benign Het
Clcn1 T C 6: 42,313,112 I827T probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col28a1 T C 6: 8,175,641 D69G possibly damaging Het
Cts3 A G 13: 61,564,992 W305R probably damaging Het
Dmwd T C 7: 19,081,159 I578T possibly damaging Het
Dnmt3a G A 12: 3,899,883 V559M probably damaging Het
Dysf T C 6: 84,039,567 V70A possibly damaging Het
Eml6 A G 11: 29,802,434 V993A probably benign Het
Etl4 T A 2: 20,807,306 L1768* probably null Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fat3 T G 9: 15,969,871 D3235A probably damaging Het
Fbxo36 T A 1: 84,900,102 F162I probably damaging Het
Fgfrl1 T C 5: 108,705,031 W200R probably damaging Het
Fsip2 T C 2: 82,980,720 M2461T possibly damaging Het
Fut1 A G 7: 45,619,219 Y144C probably benign Het
Gprin3 G A 6: 59,354,149 A391V probably benign Het
H2-Q4 A G 17: 35,379,997 E81G probably damaging Het
Hacd3 A G 9: 65,001,029 S162P probably damaging Het
Itga1 A T 13: 114,977,614 H918Q probably benign Het
Lrp5 C A 19: 3,597,430 D1271Y probably damaging Het
Lsm8 C T 6: 18,849,644 T17I probably benign Het
Mup4 T A 4: 59,958,145 D141V probably damaging Het
Nckap5 G A 1: 126,027,409 H405Y probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Ostf1 T C 19: 18,584,662 K190R probably benign Het
Pnldc1 A T 17: 12,899,890 V197E probably damaging Het
Ptprc A G 1: 138,088,532 S531P probably damaging Het
Ryr3 C T 2: 112,686,628 E3318K probably damaging Het
Scamp2 T C 9: 57,577,712 V67A possibly damaging Het
Serpina3g C A 12: 104,241,162 L195M probably damaging Het
Siglec1 G T 2: 131,074,475 T1185N possibly damaging Het
Sycp2 G A 2: 178,403,735 Q31* probably null Het
Tmprss15 T G 16: 79,057,690 T277P probably damaging Het
Trim34b C T 7: 104,329,669 S41L probably benign Het
Ttn T C 2: 76,727,361 T21507A possibly damaging Het
Umad1 T C 6: 8,427,161 V138A possibly damaging Het
Zfp523 A G 17: 28,195,209 I72M probably damaging Het
Zfp655 C T 5: 145,244,546 R405C probably benign Het
Zfp715 G A 7: 43,299,268 R423C possibly damaging Het
Other mutations in Olfr361
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Olfr361 APN 2 37085395 missense possibly damaging 0.94
IGL02210:Olfr361 APN 2 37085619 missense possibly damaging 0.54
IGL03180:Olfr361 APN 2 37085710 missense possibly damaging 0.58
R0571:Olfr361 UTSW 2 37085334 missense probably benign 0.00
R1715:Olfr361 UTSW 2 37085176 missense probably damaging 1.00
R1853:Olfr361 UTSW 2 37085220 missense probably damaging 1.00
R3009:Olfr361 UTSW 2 37085077 missense probably benign 0.00
R3713:Olfr361 UTSW 2 37085505 missense possibly damaging 0.73
R4355:Olfr361 UTSW 2 37084930 missense probably benign 0.44
R4476:Olfr361 UTSW 2 37085061 missense probably damaging 1.00
R5191:Olfr361 UTSW 2 37084978 missense probably benign 0.00
R5387:Olfr361 UTSW 2 37085719 missense possibly damaging 0.58
R5529:Olfr361 UTSW 2 37084909 missense possibly damaging 0.67
R5891:Olfr361 UTSW 2 37084978 missense probably benign 0.00
R7078:Olfr361 UTSW 2 37085596 missense possibly damaging 0.93
R7208:Olfr361 UTSW 2 37085658 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TAACCCTTGCCTCTCAGGAG -3'
(R):5'- ATCTTCACTGAGGGTGTAGCTG -3'

Sequencing Primer
(F):5'- CTCTCAGGAGATTCACTGGCATG -3'
(R):5'- TAGCTGTGGTGGTAAGCCCC -3'
Posted On2014-11-11