Incidental Mutation 'R0302:Daxx'
ID24880
Institutional Source Beutler Lab
Gene Symbol Daxx
Ensembl Gene ENSMUSG00000002307
Gene NameFas death domain-associated protein
Synonyms
MMRRC Submission 038514-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0302 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location33909414-33915589 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33913620 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 575 (S575T)
Ref Sequence ENSEMBL: ENSMUSP00000133552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053429] [ENSMUST00000079421] [ENSMUST00000170075] [ENSMUST00000172619] [ENSMUST00000173028] [ENSMUST00000173626] [ENSMUST00000174146] [ENSMUST00000174463] [ENSMUST00000174541]
Predicted Effect probably benign
Transcript: ENSMUST00000053429
SMART Domains Protein: ENSMUSP00000057466
Gene: ENSMUSG00000051390

DomainStartEndE-ValueType
low complexity region 3 30 N/A INTRINSIC
BTB 57 151 7.21e-22 SMART
low complexity region 152 176 N/A INTRINSIC
low complexity region 317 355 N/A INTRINSIC
low complexity region 390 403 N/A INTRINSIC
low complexity region 431 443 N/A INTRINSIC
low complexity region 460 479 N/A INTRINSIC
ZnF_C2H2 483 504 1.24e2 SMART
ZnF_C2H2 510 532 1.28e-3 SMART
ZnF_C2H2 538 559 4.69e0 SMART
low complexity region 567 587 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000079421
AA Change: S613T
SMART Domains Protein: ENSMUSP00000078390
Gene: ENSMUSG00000002307
AA Change: S613T

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
Pfam:Daxx 54 152 1.3e-51 PFAM
Blast:KISc 185 261 2e-17 BLAST
PDB:4H9S|F 189 404 1e-131 PDB
SCOP:d1sig__ 437 493 7e-3 SMART
low complexity region 573 584 N/A INTRINSIC
low complexity region 693 715 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000170075
AA Change: S613T
SMART Domains Protein: ENSMUSP00000128504
Gene: ENSMUSG00000002307
AA Change: S613T

DomainStartEndE-ValueType
Pfam:Daxx 1 740 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172526
Predicted Effect probably benign
Transcript: ENSMUST00000172619
SMART Domains Protein: ENSMUSP00000134695
Gene: ENSMUSG00000024308

DomainStartEndE-ValueType
PDB:3F8U|D 12 119 1e-38 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172859
Predicted Effect probably benign
Transcript: ENSMUST00000173028
SMART Domains Protein: ENSMUSP00000133319
Gene: ENSMUSG00000002307

DomainStartEndE-ValueType
Pfam:Daxx 1 137 1.6e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173279
Predicted Effect probably benign
Transcript: ENSMUST00000173626
SMART Domains Protein: ENSMUSP00000133303
Gene: ENSMUSG00000002307

DomainStartEndE-ValueType
Pfam:Daxx 1 167 6.8e-74 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000174146
AA Change: S613T
SMART Domains Protein: ENSMUSP00000134158
Gene: ENSMUSG00000002307
AA Change: S613T

DomainStartEndE-ValueType
Pfam:Daxx 1 740 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174321
Predicted Effect probably benign
Transcript: ENSMUST00000174463
SMART Domains Protein: ENSMUSP00000133345
Gene: ENSMUSG00000051390

DomainStartEndE-ValueType
low complexity region 3 30 N/A INTRINSIC
Pfam:BTB 47 87 7.9e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174467
Predicted Effect probably damaging
Transcript: ENSMUST00000174541
AA Change: S575T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133552
Gene: ENSMUSG00000002307
AA Change: S575T

DomainStartEndE-ValueType
Pfam:Daxx 1 702 1.5e-297 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174646
Meta Mutation Damage Score 0.1456 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.1%
  • 20x: 89.5%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multifunctional protein that resides in multiple locations in the nucleus and in the cytoplasm. It interacts with a wide variety of proteins, such as apoptosis antigen Fas, centromere protein C, and transcription factor erythroblastosis virus E26 oncogene homolog 1. In the nucleus, the encoded protein functions as a potent transcription repressor that binds to sumoylated transcription factors. Its repression can be relieved by the sequestration of this protein into promyelocytic leukemia nuclear bodies or nucleoli. This protein also associates with centromeres in G2 phase. In the cytoplasm, the encoded protein may function to regulate apoptosis. The subcellular localization and function of this protein are modulated by post-translational modifications, including sumoylation, phosphorylation and polyubiquitination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a targeted mutation of this gene display extensive apoptosis and embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl2 T C 4: 126,317,392 E244G probably benign Het
Aldh1l2 G A 10: 83,520,365 P54S probably damaging Het
Ankdd1a G A 9: 65,509,642 probably benign Het
Ankra2 T A 13: 98,271,692 S216R probably damaging Het
Asah2 A T 19: 32,052,956 N105K probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Cacna1s A G 1: 136,100,604 Y893C probably benign Het
Capza2 G A 6: 17,648,524 R15H probably benign Het
Cbfa2t2 T C 2: 154,534,876 probably benign Het
Ccdc96 A T 5: 36,486,101 T484S possibly damaging Het
Cckar GCTTAGCCTCTTCT GCT 5: 53,700,299 probably null Het
Ccl4 T A 11: 83,663,454 probably benign Het
Cpt1b A G 15: 89,417,870 Y702H probably benign Het
Cr1l G A 1: 195,117,793 T153I probably damaging Het
Cyth2 C A 7: 45,810,585 E57* probably null Het
Depdc5 T C 5: 32,904,546 probably benign Het
Dnah12 A G 14: 26,799,999 D1923G probably damaging Het
Dnah7b A G 1: 46,123,777 T428A probably benign Het
Dnm2 G T 9: 21,500,343 A619S probably benign Het
Enpp2 T C 15: 54,860,061 T639A probably benign Het
Epsti1 A T 14: 77,939,926 H182L probably damaging Het
Exoc3l C T 8: 105,293,543 R250Q probably benign Het
Ggn G T 7: 29,171,240 probably null Het
Il1rap A G 16: 26,692,794 N196S probably benign Het
Ints6 T C 14: 62,709,512 T335A probably damaging Het
Itga1 G A 13: 115,012,318 probably benign Het
Kifc3 G T 8: 95,103,470 Q557K possibly damaging Het
Krt23 A G 11: 99,478,201 I422T probably benign Het
Lcn2 A G 2: 32,384,889 probably benign Het
Lonp2 A G 8: 86,637,991 T326A possibly damaging Het
Lrpprc T C 17: 84,740,078 I909V possibly damaging Het
Lrrc14 G T 15: 76,714,352 R396L probably benign Het
Lypd6 T G 2: 50,165,667 probably benign Het
Man2b1 A G 8: 85,093,016 N610S probably damaging Het
Map2 A T 1: 66,414,828 N959I probably benign Het
Mctp2 C T 7: 72,090,264 V793I possibly damaging Het
Med25 A C 7: 44,880,558 probably benign Het
Mfsd6 T C 1: 52,709,457 Y83C probably damaging Het
Mtbp A T 15: 55,625,424 M499L probably damaging Het
Mtmr10 A T 7: 64,297,497 K53N probably damaging Het
Nfat5 T C 8: 107,358,701 I542T probably damaging Het
Nr1h3 A G 2: 91,192,013 M90T probably damaging Het
Nsmce4a A G 7: 130,545,893 probably benign Het
Olfr1168 T A 2: 88,185,510 I211N possibly damaging Het
Oprl1 G A 2: 181,719,228 C318Y probably benign Het
Pbx3 A T 2: 34,224,560 S46T probably benign Het
Pign A T 1: 105,589,093 F575I possibly damaging Het
Ptpn13 G T 5: 103,565,225 S1738I probably benign Het
Rnf126 G T 10: 79,759,223 P269Q probably damaging Het
Ryr3 G A 2: 112,647,123 probably benign Het
Slc2a7 C T 4: 150,149,521 A31V probably damaging Het
Slc6a12 A G 6: 121,363,259 D487G probably damaging Het
Son G T 16: 91,656,144 G593V probably damaging Het
Spata31d1a T C 13: 59,703,150 N388S probably benign Het
Spg11 A T 2: 122,092,187 M927K possibly damaging Het
Taf13 A G 3: 108,571,722 M1V probably null Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Trio A G 15: 27,902,517 F286S probably damaging Het
Trpm2 A C 10: 77,943,990 probably benign Het
Ttc7b T C 12: 100,387,179 M390V possibly damaging Het
Vmn1r184 A T 7: 26,267,543 Q238L probably damaging Het
Zfp236 T C 18: 82,658,088 E368G probably damaging Het
Zfr2 G T 10: 81,251,336 probably benign Het
Other mutations in Daxx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Daxx APN 17 33911607 nonsense probably null
IGL01066:Daxx APN 17 33913893 missense probably benign 0.43
IGL01622:Daxx APN 17 33913480 missense probably benign
IGL02245:Daxx APN 17 33912377 splice site probably benign
IGL02432:Daxx APN 17 33912337 missense probably benign 0.31
IGL02484:Daxx APN 17 33912242 missense probably damaging 1.00
IGL02992:Daxx APN 17 33911748 missense probably damaging 1.00
R0356:Daxx UTSW 17 33913893 missense probably benign 0.43
R0437:Daxx UTSW 17 33913624 missense probably benign 0.00
R0635:Daxx UTSW 17 33912644 missense probably benign 0.00
R0932:Daxx UTSW 17 33910661 missense probably damaging 1.00
R1498:Daxx UTSW 17 33912253 missense probably damaging 1.00
R1785:Daxx UTSW 17 33911842 missense probably damaging 1.00
R1996:Daxx UTSW 17 33913611 missense possibly damaging 0.89
R2367:Daxx UTSW 17 33911847 missense probably benign 0.38
R4320:Daxx UTSW 17 33911419 missense probably damaging 1.00
R4321:Daxx UTSW 17 33911406 missense possibly damaging 0.94
R5055:Daxx UTSW 17 33912160 missense probably benign 0.01
R5546:Daxx UTSW 17 33912641 small deletion probably benign
R5547:Daxx UTSW 17 33912641 small deletion probably benign
R5547:Daxx UTSW 17 33912659 small deletion probably benign
R5591:Daxx UTSW 17 33911688 missense probably damaging 1.00
R6317:Daxx UTSW 17 33911975 missense probably damaging 1.00
R6362:Daxx UTSW 17 33911364 missense probably damaging 1.00
R6493:Daxx UTSW 17 33912371 critical splice donor site probably null
R7100:Daxx UTSW 17 33911442 missense probably damaging 1.00
R7176:Daxx UTSW 17 33913318 missense unknown
R7310:Daxx UTSW 17 33910461 missense possibly damaging 0.70
R7418:Daxx UTSW 17 33910605 missense probably benign 0.05
R7476:Daxx UTSW 17 33911281 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAGAGTCCCACATCGCCTTCAG -3'
(R):5'- TGGACACTTGTGTTCTGCCCACTG -3'

Sequencing Primer
(F):5'- TTCCATAGAAGGAATTCAGAGCCTG -3'
(R):5'- CGGTTCTTTTATATAGCTAAGGACAG -3'
Posted On2013-04-16