Incidental Mutation 'R2403:Lsm8'
ID248811
Institutional Source Beutler Lab
Gene Symbol Lsm8
Ensembl Gene ENSMUSG00000044155
Gene NameLSM8 homolog, U6 small nuclear RNA associated
SynonymsLsm8, 2010003I05Rik
MMRRC Submission 040369-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R2403 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location18848579-18855751 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 18849644 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 17 (T17I)
Ref Sequence ENSEMBL: ENSMUSP00000057238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056398] [ENSMUST00000201141]
Predicted Effect probably benign
Transcript: ENSMUST00000056398
AA Change: T17I

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000057238
Gene: ENSMUSG00000044155
AA Change: T17I

DomainStartEndE-ValueType
Sm 3 72 2.83e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128526
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136982
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180863
Predicted Effect probably benign
Transcript: ENSMUST00000201141
SMART Domains Protein: ENSMUSP00000144884
Gene: ENSMUSG00000044155

DomainStartEndE-ValueType
Sm 8 76 1.3e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201775
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202148
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202542
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the like-Sm family of proteins. The encoded protein consists of a closed barrel shape, made up of five anti-parallel beta strands and an alpha helix. This protein partners with six paralogs to form a heteroheptameric ring which transiently binds U6 small nuclear RNAs and is involved in the general maturation of RNA in the nucleus. [provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,170,943 E925G probably damaging Het
Abca9 T G 11: 110,115,454 Q1275P probably benign Het
Adgrl1 T A 8: 83,931,241 M492K probably benign Het
Ankrd50 T A 3: 38,483,085 K3* probably null Het
Arl5b T C 2: 15,075,037 S140P probably damaging Het
Armc1 T C 3: 19,157,676 probably benign Het
Ascc1 T C 10: 60,004,841 I8T probably benign Het
Bche A G 3: 73,701,472 V207A probably damaging Het
Cacna2d3 A G 14: 28,905,302 L1080P probably benign Het
Ceacam3 C A 7: 17,161,854 A583D probably damaging Het
Cep290 C T 10: 100,537,437 A1193V probably benign Het
Clcn1 T C 6: 42,313,112 I827T probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col28a1 T C 6: 8,175,641 D69G possibly damaging Het
Cts3 A G 13: 61,564,992 W305R probably damaging Het
Dmwd T C 7: 19,081,159 I578T possibly damaging Het
Dnmt3a G A 12: 3,899,883 V559M probably damaging Het
Dysf T C 6: 84,039,567 V70A possibly damaging Het
Eml6 A G 11: 29,802,434 V993A probably benign Het
Etl4 T A 2: 20,807,306 L1768* probably null Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fat3 T G 9: 15,969,871 D3235A probably damaging Het
Fbxo36 T A 1: 84,900,102 F162I probably damaging Het
Fgfrl1 T C 5: 108,705,031 W200R probably damaging Het
Fsip2 T C 2: 82,980,720 M2461T possibly damaging Het
Fut1 A G 7: 45,619,219 Y144C probably benign Het
Gprin3 G A 6: 59,354,149 A391V probably benign Het
H2-Q4 A G 17: 35,379,997 E81G probably damaging Het
Hacd3 A G 9: 65,001,029 S162P probably damaging Het
Itga1 A T 13: 114,977,614 H918Q probably benign Het
Lrp5 C A 19: 3,597,430 D1271Y probably damaging Het
Mup4 T A 4: 59,958,145 D141V probably damaging Het
Nckap5 G A 1: 126,027,409 H405Y probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr361 T C 2: 37,084,974 Y258C probably benign Het
Ostf1 T C 19: 18,584,662 K190R probably benign Het
Pnldc1 A T 17: 12,899,890 V197E probably damaging Het
Ptprc A G 1: 138,088,532 S531P probably damaging Het
Ryr3 C T 2: 112,686,628 E3318K probably damaging Het
Scamp2 T C 9: 57,577,712 V67A possibly damaging Het
Serpina3g C A 12: 104,241,162 L195M probably damaging Het
Siglec1 G T 2: 131,074,475 T1185N possibly damaging Het
Sycp2 G A 2: 178,403,735 Q31* probably null Het
Tmprss15 T G 16: 79,057,690 T277P probably damaging Het
Trim34b C T 7: 104,329,669 S41L probably benign Het
Ttn T C 2: 76,727,361 T21507A possibly damaging Het
Umad1 T C 6: 8,427,161 V138A possibly damaging Het
Zfp523 A G 17: 28,195,209 I72M probably damaging Het
Zfp655 C T 5: 145,244,546 R405C probably benign Het
Zfp715 G A 7: 43,299,268 R423C possibly damaging Het
Other mutations in Lsm8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01519:Lsm8 APN 6 18851700 missense probably damaging 1.00
IGL02529:Lsm8 APN 6 18851652 missense probably damaging 1.00
LCD18:Lsm8 UTSW 6 18844316 unclassified probably benign
LCD18:Lsm8 UTSW 6 18854321 unclassified probably benign
R1496:Lsm8 UTSW 6 18849659 missense probably benign 0.00
R4184:Lsm8 UTSW 6 18849605 intron probably benign
R5630:Lsm8 UTSW 6 18851673 missense probably damaging 1.00
R6345:Lsm8 UTSW 6 18853645 missense probably damaging 1.00
R6404:Lsm8 UTSW 6 18848740 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- TCCCATGTGATGAACTGTTTTCG -3'
(R):5'- ATCTGTACAGGTAGCCAAGAGAC -3'

Sequencing Primer
(F):5'- CATGTGATGAACTGTTTTCGAGGTAC -3'
(R):5'- CTGTACAGGTAGCCAAGAGACTAAGG -3'
Posted On2014-11-11