Incidental Mutation 'R2403:Fut1'
ID248818
Institutional Source Beutler Lab
Gene Symbol Fut1
Ensembl Gene ENSMUSG00000008461
Gene Namefucosyltransferase 1
SynonymsH transferase
MMRRC Submission 040369-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2403 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location45617289-45621059 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45619219 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 144 (Y144C)
Ref Sequence ENSEMBL: ENSMUSP00000147274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008605] [ENSMUST00000033099] [ENSMUST00000033100] [ENSMUST00000209379] [ENSMUST00000210150]
Predicted Effect probably benign
Transcript: ENSMUST00000008605
AA Change: Y199C

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000008605
Gene: ENSMUSG00000008461
AA Change: Y199C

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:Glyco_transf_11 39 355 3.1e-126 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000033099
SMART Domains Protein: ENSMUSP00000033099
Gene: ENSMUSG00000030827

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
FGF 44 169 3.95e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000033100
SMART Domains Protein: ENSMUSP00000033100
Gene: ENSMUSG00000064158

DomainStartEndE-ValueType
low complexity region 7 13 N/A INTRINSIC
Pfam:IZUMO 21 166 2.6e-53 PFAM
IG 167 253 2.43e-2 SMART
transmembrane domain 320 342 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209379
AA Change: Y144C

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000210150
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene is one of three genes in mouse which encode a galactoside 2-L-fucosyltransferase. These genes differ in their developmental- and tissue-specific expression. The encoded type II membrane protein is anchored in the Golgi apparatus and controls the final step in the creation of alpha (1,2) fucosylated carbhohydrates by the addition of a terminal fucose in an alpha (1,2) linkage. This enzyme is required for the synthesis of the Lewis antigen as well as the H-antigen, a precursor of the A and B antigens of the ABH histo-blood group. The biological function of the fucosylated carbhohydrate products is thought to involve cell-adhesion and interactions with microorganisms. Disruption of this gene impairs development of the olfactory nerve and maturation of the glomerular layer of the main olfactory bulb. Alternative splicing results in multiple transcript variants which encode distinct isoforms. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygous null mice are viable and healthy, lack alpha(1,2)fucose residues from the apical surface of pancreatic acinar glands and are deficient in epididymal cell surface alpha(1,2)fucosylated glycans but show normal male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,170,943 E925G probably damaging Het
Abca9 T G 11: 110,115,454 Q1275P probably benign Het
Adgrl1 T A 8: 83,931,241 M492K probably benign Het
Ankrd50 T A 3: 38,483,085 K3* probably null Het
Arl5b T C 2: 15,075,037 S140P probably damaging Het
Armc1 T C 3: 19,157,676 probably benign Het
Ascc1 T C 10: 60,004,841 I8T probably benign Het
Bche A G 3: 73,701,472 V207A probably damaging Het
Cacna2d3 A G 14: 28,905,302 L1080P probably benign Het
Ceacam3 C A 7: 17,161,854 A583D probably damaging Het
Cep290 C T 10: 100,537,437 A1193V probably benign Het
Clcn1 T C 6: 42,313,112 I827T probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col28a1 T C 6: 8,175,641 D69G possibly damaging Het
Cts3 A G 13: 61,564,992 W305R probably damaging Het
Dmwd T C 7: 19,081,159 I578T possibly damaging Het
Dnmt3a G A 12: 3,899,883 V559M probably damaging Het
Dysf T C 6: 84,039,567 V70A possibly damaging Het
Eml6 A G 11: 29,802,434 V993A probably benign Het
Etl4 T A 2: 20,807,306 L1768* probably null Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fat3 T G 9: 15,969,871 D3235A probably damaging Het
Fbxo36 T A 1: 84,900,102 F162I probably damaging Het
Fgfrl1 T C 5: 108,705,031 W200R probably damaging Het
Fsip2 T C 2: 82,980,720 M2461T possibly damaging Het
Gprin3 G A 6: 59,354,149 A391V probably benign Het
H2-Q4 A G 17: 35,379,997 E81G probably damaging Het
Hacd3 A G 9: 65,001,029 S162P probably damaging Het
Itga1 A T 13: 114,977,614 H918Q probably benign Het
Lrp5 C A 19: 3,597,430 D1271Y probably damaging Het
Lsm8 C T 6: 18,849,644 T17I probably benign Het
Mup4 T A 4: 59,958,145 D141V probably damaging Het
Nckap5 G A 1: 126,027,409 H405Y probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr361 T C 2: 37,084,974 Y258C probably benign Het
Ostf1 T C 19: 18,584,662 K190R probably benign Het
Pnldc1 A T 17: 12,899,890 V197E probably damaging Het
Ptprc A G 1: 138,088,532 S531P probably damaging Het
Ryr3 C T 2: 112,686,628 E3318K probably damaging Het
Scamp2 T C 9: 57,577,712 V67A possibly damaging Het
Serpina3g C A 12: 104,241,162 L195M probably damaging Het
Siglec1 G T 2: 131,074,475 T1185N possibly damaging Het
Sycp2 G A 2: 178,403,735 Q31* probably null Het
Tmprss15 T G 16: 79,057,690 T277P probably damaging Het
Trim34b C T 7: 104,329,669 S41L probably benign Het
Ttn T C 2: 76,727,361 T21507A possibly damaging Het
Umad1 T C 6: 8,427,161 V138A possibly damaging Het
Zfp523 A G 17: 28,195,209 I72M probably damaging Het
Zfp655 C T 5: 145,244,546 R405C probably benign Het
Zfp715 G A 7: 43,299,268 R423C possibly damaging Het
Other mutations in Fut1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Fut1 APN 7 45619431 missense probably damaging 1.00
IGL02015:Fut1 APN 7 45618975 missense probably damaging 0.98
IGL02232:Fut1 APN 7 45619447 missense probably damaging 1.00
IGL02934:Fut1 APN 7 45618703 missense possibly damaging 0.49
IGL02976:Fut1 APN 7 45619320 missense probably damaging 1.00
IGL03091:Fut1 APN 7 45619527 missense probably damaging 1.00
IGL03169:Fut1 APN 7 45619033 missense probably benign 0.05
R0107:Fut1 UTSW 7 45618846 missense possibly damaging 0.50
R0107:Fut1 UTSW 7 45618846 missense possibly damaging 0.50
R1413:Fut1 UTSW 7 45619428 missense probably damaging 0.98
R2039:Fut1 UTSW 7 45618991 missense possibly damaging 0.62
R2516:Fut1 UTSW 7 45619198 missense probably benign 0.03
R3429:Fut1 UTSW 7 45619374 missense probably damaging 1.00
R3430:Fut1 UTSW 7 45619374 missense probably damaging 1.00
R5775:Fut1 UTSW 7 45619462 missense probably damaging 1.00
R6244:Fut1 UTSW 7 45619306 missense possibly damaging 0.79
R6961:Fut1 UTSW 7 45619539 missense probably damaging 0.99
R7052:Fut1 UTSW 7 45619757 makesense probably null
R8027:Fut1 UTSW 7 45618865 missense probably damaging 1.00
Z1177:Fut1 UTSW 7 45619229 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCTTGGCAGCACTTAGTCC -3'
(R):5'- GGATGTGTCAATGTTCTCCAAAC -3'

Sequencing Primer
(F):5'- GCACTTAGTCCTACATGACTGGATG -3'
(R):5'- CCATTGCTGGTGACCACAAAGATG -3'
Posted On2014-11-11