Incidental Mutation 'R2403:Trim34b'
ID248819
Institutional Source Beutler Lab
Gene Symbol Trim34b
Ensembl Gene ENSMUSG00000090215
Gene Nametripartite motif-containing 34B
SynonymsTrim34-2, Gm15134
MMRRC Submission 040369-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.189) question?
Stock #R2403 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location104329471-104336909 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 104329669 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 41 (S41L)
Ref Sequence ENSEMBL: ENSMUSP00000136926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106847] [ENSMUST00000180136]
Predicted Effect probably benign
Transcript: ENSMUST00000106847
AA Change: S41L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102460
Gene: ENSMUSG00000090215
AA Change: S41L

DomainStartEndE-ValueType
RING 15 58 7.8e-7 SMART
ZnF_RBZ 31 61 5.96e-1 SMART
BBOX 91 132 2.15e-9 SMART
low complexity region 195 209 N/A INTRINSIC
Blast:PRY 299 343 3e-21 BLAST
Pfam:SPRY 347 474 7.8e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139019
Predicted Effect probably benign
Transcript: ENSMUST00000180136
AA Change: S41L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000136926
Gene: ENSMUSG00000090215
AA Change: S41L

DomainStartEndE-ValueType
RING 15 58 7.8e-7 SMART
ZnF_RBZ 31 61 5.96e-1 SMART
BBOX 91 132 2.15e-9 SMART
low complexity region 195 209 N/A INTRINSIC
Blast:PRY 299 343 2e-21 BLAST
Pfam:SPRY 345 484 3e-20 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,170,943 E925G probably damaging Het
Abca9 T G 11: 110,115,454 Q1275P probably benign Het
Adgrl1 T A 8: 83,931,241 M492K probably benign Het
Ankrd50 T A 3: 38,483,085 K3* probably null Het
Arl5b T C 2: 15,075,037 S140P probably damaging Het
Armc1 T C 3: 19,157,676 probably benign Het
Ascc1 T C 10: 60,004,841 I8T probably benign Het
Bche A G 3: 73,701,472 V207A probably damaging Het
Cacna2d3 A G 14: 28,905,302 L1080P probably benign Het
Ceacam3 C A 7: 17,161,854 A583D probably damaging Het
Cep290 C T 10: 100,537,437 A1193V probably benign Het
Clcn1 T C 6: 42,313,112 I827T probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col28a1 T C 6: 8,175,641 D69G possibly damaging Het
Cts3 A G 13: 61,564,992 W305R probably damaging Het
Dmwd T C 7: 19,081,159 I578T possibly damaging Het
Dnmt3a G A 12: 3,899,883 V559M probably damaging Het
Dysf T C 6: 84,039,567 V70A possibly damaging Het
Eml6 A G 11: 29,802,434 V993A probably benign Het
Etl4 T A 2: 20,807,306 L1768* probably null Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fat3 T G 9: 15,969,871 D3235A probably damaging Het
Fbxo36 T A 1: 84,900,102 F162I probably damaging Het
Fgfrl1 T C 5: 108,705,031 W200R probably damaging Het
Fsip2 T C 2: 82,980,720 M2461T possibly damaging Het
Fut1 A G 7: 45,619,219 Y144C probably benign Het
Gprin3 G A 6: 59,354,149 A391V probably benign Het
H2-Q4 A G 17: 35,379,997 E81G probably damaging Het
Hacd3 A G 9: 65,001,029 S162P probably damaging Het
Itga1 A T 13: 114,977,614 H918Q probably benign Het
Lrp5 C A 19: 3,597,430 D1271Y probably damaging Het
Lsm8 C T 6: 18,849,644 T17I probably benign Het
Mup4 T A 4: 59,958,145 D141V probably damaging Het
Nckap5 G A 1: 126,027,409 H405Y probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr361 T C 2: 37,084,974 Y258C probably benign Het
Ostf1 T C 19: 18,584,662 K190R probably benign Het
Pnldc1 A T 17: 12,899,890 V197E probably damaging Het
Ptprc A G 1: 138,088,532 S531P probably damaging Het
Ryr3 C T 2: 112,686,628 E3318K probably damaging Het
Scamp2 T C 9: 57,577,712 V67A possibly damaging Het
Serpina3g C A 12: 104,241,162 L195M probably damaging Het
Siglec1 G T 2: 131,074,475 T1185N possibly damaging Het
Sycp2 G A 2: 178,403,735 Q31* probably null Het
Tmprss15 T G 16: 79,057,690 T277P probably damaging Het
Ttn T C 2: 76,727,361 T21507A possibly damaging Het
Umad1 T C 6: 8,427,161 V138A possibly damaging Het
Zfp523 A G 17: 28,195,209 I72M probably damaging Het
Zfp655 C T 5: 145,244,546 R405C probably benign Het
Zfp715 G A 7: 43,299,268 R423C possibly damaging Het
Other mutations in Trim34b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Trim34b APN 7 104329652 nonsense probably null
IGL01103:Trim34b APN 7 104329899 missense probably damaging 1.00
IGL02252:Trim34b APN 7 104329932 missense probably damaging 0.98
IGL03241:Trim34b APN 7 104334613 intron probably benign
R0032:Trim34b UTSW 7 104336577 missense possibly damaging 0.61
R0381:Trim34b UTSW 7 104329855 missense probably damaging 1.00
R2520:Trim34b UTSW 7 104331239 missense probably damaging 1.00
R2857:Trim34b UTSW 7 104336232 missense probably benign 0.00
R2859:Trim34b UTSW 7 104336232 missense probably benign 0.00
R3077:Trim34b UTSW 7 104331301 missense possibly damaging 0.89
R4094:Trim34b UTSW 7 104334588 missense probably benign
R4449:Trim34b UTSW 7 104335728 missense probably benign 0.00
R5183:Trim34b UTSW 7 104329911 missense possibly damaging 0.92
R5700:Trim34b UTSW 7 104336411 missense probably damaging 1.00
R5759:Trim34b UTSW 7 104331433 missense possibly damaging 0.46
R6236:Trim34b UTSW 7 104336318 missense probably damaging 0.99
R6364:Trim34b UTSW 7 104336526 missense probably damaging 0.99
R7034:Trim34b UTSW 7 104329536 start gained probably benign
R7036:Trim34b UTSW 7 104329536 start gained probably benign
R7237:Trim34b UTSW 7 104329587 missense possibly damaging 0.80
R7392:Trim34b UTSW 7 104336397 missense probably benign 0.00
R7405:Trim34b UTSW 7 104336483 missense probably damaging 1.00
R7516:Trim34b UTSW 7 104329711 missense probably damaging 1.00
R7646:Trim34b UTSW 7 104335352 missense probably damaging 0.97
R7909:Trim34b UTSW 7 104330524 missense probably benign 0.01
R8396:Trim34b UTSW 7 104329876 missense probably damaging 1.00
R8472:Trim34b UTSW 7 104331338 missense probably benign 0.00
R8806:Trim34b UTSW 7 104336112 missense probably damaging 1.00
Z1176:Trim34b UTSW 7 104335314 missense probably damaging 1.00
Z1177:Trim34b UTSW 7 104331353 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- AGCCATCCAGCAGTCCTTAAG -3'
(R):5'- TGTCCTCCTTACAGAAGAGAAGG -3'

Sequencing Primer
(F):5'- GCAGTCCTTAAGAAAGAAGAGCCTC -3'
(R):5'- CTCTCCATGGTGTACACAGAG -3'
Posted On2014-11-11