Incidental Mutation 'R0302:Lrpprc'
ID24882
Institutional Source Beutler Lab
Gene Symbol Lrpprc
Ensembl Gene ENSMUSG00000024120
Gene Nameleucine-rich PPR-motif containing
Synonyms3110001K13Rik, Lrp130
MMRRC Submission 038514-MU
Accession Numbers

Ncbi RefSeq: NM_028233.2; MGI:1919666

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0302 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location84705247-84790789 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84740078 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 909 (I909V)
Ref Sequence ENSEMBL: ENSMUSP00000107927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112308]
Predicted Effect possibly damaging
Transcript: ENSMUST00000112308
AA Change: I909V

PolyPhen 2 Score 0.763 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107927
Gene: ENSMUSG00000024120
AA Change: I909V

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 32 50 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Pfam:PPR_3 196 228 9.1e-4 PFAM
Pfam:PPR 197 227 2.3e-4 PFAM
Pfam:PPR_3 231 264 7.9e-6 PFAM
Pfam:PPR 232 262 4e-4 PFAM
Pfam:PPR_3 266 297 9.7e-3 PFAM
internal_repeat_2 391 477 3.13e-7 PROSPERO
Pfam:PPR 750 778 3.4e-4 PFAM
low complexity region 1017 1028 N/A INTRINSIC
internal_repeat_1 1042 1362 1.09e-11 PROSPERO
low complexity region 1366 1375 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160011
Meta Mutation Damage Score 0.0603 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.1%
  • 20x: 89.5%
Validation Efficiency 100% (63/63)
MGI Phenotype Strain: 3857306; 5438913
Lethality: E10-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a leucine-rich protein that has multiple pentatricopeptide repeats (PPR). The precise role of this protein is unknown but studies suggest it may play a role in cytoskeletal organization, vesicular transport, or in transcriptional regulation of both nuclear and mitochondrial genes. The protein localizes primarily to mitochondria and is predicted to have an N-terminal mitochondrial targeting sequence. Mutations in this gene are associated with the French-Canadian type of Leigh syndrome. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality during organogenesis associated with growth retardation. Mice homozygous for a knock-out allele exhibit embryonic lethality between somite formation and embryo turning. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted(3) Gene trapped(10)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl2 T C 4: 126,317,392 E244G probably benign Het
Aldh1l2 G A 10: 83,520,365 P54S probably damaging Het
Ankdd1a G A 9: 65,509,642 probably benign Het
Ankra2 T A 13: 98,271,692 S216R probably damaging Het
Asah2 A T 19: 32,052,956 N105K probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Cacna1s A G 1: 136,100,604 Y893C probably benign Het
Capza2 G A 6: 17,648,524 R15H probably benign Het
Cbfa2t2 T C 2: 154,534,876 probably benign Het
Ccdc96 A T 5: 36,486,101 T484S possibly damaging Het
Cckar GCTTAGCCTCTTCT GCT 5: 53,700,299 probably null Het
Ccl4 T A 11: 83,663,454 probably benign Het
Cpt1b A G 15: 89,417,870 Y702H probably benign Het
Cr1l G A 1: 195,117,793 T153I probably damaging Het
Cyth2 C A 7: 45,810,585 E57* probably null Het
Daxx T A 17: 33,913,620 S575T probably damaging Het
Depdc5 T C 5: 32,904,546 probably benign Het
Dnah12 A G 14: 26,799,999 D1923G probably damaging Het
Dnah7b A G 1: 46,123,777 T428A probably benign Het
Dnm2 G T 9: 21,500,343 A619S probably benign Het
Enpp2 T C 15: 54,860,061 T639A probably benign Het
Epsti1 A T 14: 77,939,926 H182L probably damaging Het
Exoc3l C T 8: 105,293,543 R250Q probably benign Het
Ggn G T 7: 29,171,240 probably null Het
Il1rap A G 16: 26,692,794 N196S probably benign Het
Ints6 T C 14: 62,709,512 T335A probably damaging Het
Itga1 G A 13: 115,012,318 probably benign Het
Kifc3 G T 8: 95,103,470 Q557K possibly damaging Het
Krt23 A G 11: 99,478,201 I422T probably benign Het
Lcn2 A G 2: 32,384,889 probably benign Het
Lonp2 A G 8: 86,637,991 T326A possibly damaging Het
Lrrc14 G T 15: 76,714,352 R396L probably benign Het
Lypd6 T G 2: 50,165,667 probably benign Het
Man2b1 A G 8: 85,093,016 N610S probably damaging Het
Map2 A T 1: 66,414,828 N959I probably benign Het
Mctp2 C T 7: 72,090,264 V793I possibly damaging Het
Med25 A C 7: 44,880,558 probably benign Het
Mfsd6 T C 1: 52,709,457 Y83C probably damaging Het
Mtbp A T 15: 55,625,424 M499L probably damaging Het
Mtmr10 A T 7: 64,297,497 K53N probably damaging Het
Nfat5 T C 8: 107,358,701 I542T probably damaging Het
Nr1h3 A G 2: 91,192,013 M90T probably damaging Het
Nsmce4a A G 7: 130,545,893 probably benign Het
Olfr1168 T A 2: 88,185,510 I211N possibly damaging Het
Oprl1 G A 2: 181,719,228 C318Y probably benign Het
Pbx3 A T 2: 34,224,560 S46T probably benign Het
Pign A T 1: 105,589,093 F575I possibly damaging Het
Ptpn13 G T 5: 103,565,225 S1738I probably benign Het
Rnf126 G T 10: 79,759,223 P269Q probably damaging Het
Ryr3 G A 2: 112,647,123 probably benign Het
Slc2a7 C T 4: 150,149,521 A31V probably damaging Het
Slc6a12 A G 6: 121,363,259 D487G probably damaging Het
Son G T 16: 91,656,144 G593V probably damaging Het
Spata31d1a T C 13: 59,703,150 N388S probably benign Het
Spg11 A T 2: 122,092,187 M927K possibly damaging Het
Taf13 A G 3: 108,571,722 M1V probably null Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Trio A G 15: 27,902,517 F286S probably damaging Het
Trpm2 A C 10: 77,943,990 probably benign Het
Ttc7b T C 12: 100,387,179 M390V possibly damaging Het
Vmn1r184 A T 7: 26,267,543 Q238L probably damaging Het
Zfp236 T C 18: 82,658,088 E368G probably damaging Het
Zfr2 G T 10: 81,251,336 probably benign Het
Other mutations in Lrpprc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Lrpprc APN 17 84750525 missense possibly damaging 0.91
IGL01319:Lrpprc APN 17 84705412 utr 3 prime probably benign
IGL01380:Lrpprc APN 17 84722730 missense probably benign
IGL01560:Lrpprc APN 17 84708119 missense probably benign 0.07
IGL01582:Lrpprc APN 17 84754543 missense probably null 0.00
IGL01996:Lrpprc APN 17 84773270 missense probably benign
IGL02109:Lrpprc APN 17 84726570 nonsense probably null
IGL02163:Lrpprc APN 17 84753472 missense probably damaging 0.97
IGL02248:Lrpprc APN 17 84771467 missense probably damaging 0.99
IGL02503:Lrpprc APN 17 84726339 missense probably benign
IGL02545:Lrpprc APN 17 84775425 missense probably benign
IGL02570:Lrpprc APN 17 84750553 missense probably damaging 1.00
IGL02636:Lrpprc APN 17 84753104 unclassified probably benign
IGL02943:Lrpprc APN 17 84771450 missense probably benign 0.00
IGL03008:Lrpprc APN 17 84751247 missense probably benign 0.05
R6807_Lrpprc_629 UTSW 17 84749103 missense possibly damaging 0.93
P0023:Lrpprc UTSW 17 84726338 missense probably benign 0.00
R0027:Lrpprc UTSW 17 84767007 nonsense probably null
R0027:Lrpprc UTSW 17 84767007 nonsense probably null
R0389:Lrpprc UTSW 17 84753112 critical splice donor site probably null
R0448:Lrpprc UTSW 17 84770894 missense probably benign 0.09
R1396:Lrpprc UTSW 17 84726303 missense possibly damaging 0.68
R1759:Lrpprc UTSW 17 84740081 missense probably damaging 1.00
R2019:Lrpprc UTSW 17 84752331 missense possibly damaging 0.56
R2169:Lrpprc UTSW 17 84770077 missense probably benign 0.00
R2312:Lrpprc UTSW 17 84773258 missense probably damaging 0.96
R2319:Lrpprc UTSW 17 84726390 missense probably benign
R2568:Lrpprc UTSW 17 84726649 missense probably damaging 1.00
R3013:Lrpprc UTSW 17 84767069 missense probably benign 0.04
R3620:Lrpprc UTSW 17 84770024 missense probably benign 0.01
R3789:Lrpprc UTSW 17 84771528 missense probably benign 0.25
R3848:Lrpprc UTSW 17 84770927 missense probably benign 0.01
R3973:Lrpprc UTSW 17 84770841 critical splice donor site probably null
R4111:Lrpprc UTSW 17 84726338 missense probably benign 0.00
R4164:Lrpprc UTSW 17 84731189 missense possibly damaging 0.47
R4331:Lrpprc UTSW 17 84740542 critical splice donor site probably null
R4531:Lrpprc UTSW 17 84712787 missense probably benign 0.01
R4832:Lrpprc UTSW 17 84707156 missense probably benign 0.24
R4947:Lrpprc UTSW 17 84771538 missense probably benign 0.02
R5134:Lrpprc UTSW 17 84751256 missense probably benign 0.00
R5333:Lrpprc UTSW 17 84790393 missense probably benign 0.01
R5950:Lrpprc UTSW 17 84740170 missense possibly damaging 0.86
R5972:Lrpprc UTSW 17 84712822 missense possibly damaging 0.88
R6185:Lrpprc UTSW 17 84767024 missense probably benign
R6253:Lrpprc UTSW 17 84740637 missense probably benign 0.00
R6488:Lrpprc UTSW 17 84751353 missense probably damaging 1.00
R6807:Lrpprc UTSW 17 84749103 missense possibly damaging 0.93
R6911:Lrpprc UTSW 17 84756283 missense possibly damaging 0.67
R6933:Lrpprc UTSW 17 84722703 missense probably benign 0.42
R6955:Lrpprc UTSW 17 84776989 missense probably damaging 0.98
R7448:Lrpprc UTSW 17 84772139 missense probably damaging 0.99
R7727:Lrpprc UTSW 17 84776947 missense probably benign 0.00
R8003:Lrpprc UTSW 17 84752317 missense probably benign 0.01
X0026:Lrpprc UTSW 17 84710662 missense probably benign 0.42
Z1088:Lrpprc UTSW 17 84731784 nonsense probably null
Z1088:Lrpprc UTSW 17 84770500 critical splice acceptor site probably null
Z1176:Lrpprc UTSW 17 84770431 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ACGAATAAATCTGAGCCTGGTCTGC -3'
(R):5'- AAGAAGCCTCTGGCTTTCCGTGTC -3'

Sequencing Primer
(F):5'- GGATTAGCAACTTTACACCCAGG -3'
(R):5'- CTCTTAAGTGTGTAATGCCATCAG -3'
Posted On2013-04-16