Incidental Mutation 'R0302:Lrpprc'
ID 24882
Institutional Source Beutler Lab
Gene Symbol Lrpprc
Ensembl Gene ENSMUSG00000024120
Gene Name leucine-rich PPR-motif containing
Synonyms Lrp130, 3110001K13Rik
MMRRC Submission 038514-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0302 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 85012675-85098214 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 85047506 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 909 (I909V)
Ref Sequence ENSEMBL: ENSMUSP00000107927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112308]
AlphaFold Q6PB66
Predicted Effect possibly damaging
Transcript: ENSMUST00000112308
AA Change: I909V

PolyPhen 2 Score 0.763 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107927
Gene: ENSMUSG00000024120
AA Change: I909V

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 32 50 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Pfam:PPR_3 196 228 9.1e-4 PFAM
Pfam:PPR 197 227 2.3e-4 PFAM
Pfam:PPR_3 231 264 7.9e-6 PFAM
Pfam:PPR 232 262 4e-4 PFAM
Pfam:PPR_3 266 297 9.7e-3 PFAM
internal_repeat_2 391 477 3.13e-7 PROSPERO
Pfam:PPR 750 778 3.4e-4 PFAM
low complexity region 1017 1028 N/A INTRINSIC
internal_repeat_1 1042 1362 1.09e-11 PROSPERO
low complexity region 1366 1375 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160011
Meta Mutation Damage Score 0.0603 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.1%
  • 20x: 89.5%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a leucine-rich protein that has multiple pentatricopeptide repeats (PPR). The precise role of this protein is unknown but studies suggest it may play a role in cytoskeletal organization, vesicular transport, or in transcriptional regulation of both nuclear and mitochondrial genes. The protein localizes primarily to mitochondria and is predicted to have an N-terminal mitochondrial targeting sequence. Mutations in this gene are associated with the French-Canadian type of Leigh syndrome. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality during organogenesis associated with growth retardation. Mice homozygous for a knock-out allele exhibit embryonic lethality between somite formation and embryo turning. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted(3) Gene trapped(10)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprs T C 4: 126,211,185 (GRCm39) E244G probably benign Het
Aldh1l2 G A 10: 83,356,229 (GRCm39) P54S probably damaging Het
Ankdd1a G A 9: 65,416,924 (GRCm39) probably benign Het
Ankra2 T A 13: 98,408,200 (GRCm39) S216R probably damaging Het
Asah2 A T 19: 32,030,356 (GRCm39) N105K probably benign Het
Ass1 A T 2: 31,404,831 (GRCm39) N371Y probably damaging Het
Cacna1s A G 1: 136,028,342 (GRCm39) Y893C probably benign Het
Capza2 G A 6: 17,648,523 (GRCm39) R15H probably benign Het
Cbfa2t2 T C 2: 154,376,796 (GRCm39) probably benign Het
Ccdc96 A T 5: 36,643,445 (GRCm39) T484S possibly damaging Het
Cckar GCTTAGCCTCTTCT GCT 5: 53,857,641 (GRCm39) probably null Het
Ccl4 T A 11: 83,554,280 (GRCm39) probably benign Het
Cpt1b A G 15: 89,302,073 (GRCm39) Y702H probably benign Het
Cr1l G A 1: 194,800,101 (GRCm39) T153I probably damaging Het
Cyth2 C A 7: 45,460,009 (GRCm39) E57* probably null Het
Daxx T A 17: 34,132,594 (GRCm39) S575T probably damaging Het
Depdc5 T C 5: 33,061,890 (GRCm39) probably benign Het
Dnah12 A G 14: 26,521,956 (GRCm39) D1923G probably damaging Het
Dnah7b A G 1: 46,162,937 (GRCm39) T428A probably benign Het
Dnm2 G T 9: 21,411,639 (GRCm39) A619S probably benign Het
Enpp2 T C 15: 54,723,457 (GRCm39) T639A probably benign Het
Epsti1 A T 14: 78,177,366 (GRCm39) H182L probably damaging Het
Exoc3l C T 8: 106,020,175 (GRCm39) R250Q probably benign Het
Ggn G T 7: 28,870,665 (GRCm39) probably null Het
Il1rap A G 16: 26,511,544 (GRCm39) N196S probably benign Het
Ints6 T C 14: 62,946,961 (GRCm39) T335A probably damaging Het
Itga1 G A 13: 115,148,854 (GRCm39) probably benign Het
Kifc3 G T 8: 95,830,098 (GRCm39) Q557K possibly damaging Het
Krt23 A G 11: 99,369,027 (GRCm39) I422T probably benign Het
Lcn2 A G 2: 32,274,901 (GRCm39) probably benign Het
Lonp2 A G 8: 87,364,619 (GRCm39) T326A possibly damaging Het
Lrrc14 G T 15: 76,598,552 (GRCm39) R396L probably benign Het
Lypd6 T G 2: 50,055,679 (GRCm39) probably benign Het
Man2b1 A G 8: 85,819,645 (GRCm39) N610S probably damaging Het
Map2 A T 1: 66,453,987 (GRCm39) N959I probably benign Het
Mctp2 C T 7: 71,740,012 (GRCm39) V793I possibly damaging Het
Med25 A C 7: 44,529,982 (GRCm39) probably benign Het
Mfsd6 T C 1: 52,748,616 (GRCm39) Y83C probably damaging Het
Mtbp A T 15: 55,488,820 (GRCm39) M499L probably damaging Het
Mtmr10 A T 7: 63,947,245 (GRCm39) K53N probably damaging Het
Nfat5 T C 8: 108,085,333 (GRCm39) I542T probably damaging Het
Nr1h3 A G 2: 91,022,358 (GRCm39) M90T probably damaging Het
Nsmce4a A G 7: 130,147,623 (GRCm39) probably benign Het
Oprl1 G A 2: 181,361,021 (GRCm39) C318Y probably benign Het
Or5d40 T A 2: 88,015,854 (GRCm39) I211N possibly damaging Het
Pbx3 A T 2: 34,114,572 (GRCm39) S46T probably benign Het
Pign A T 1: 105,516,818 (GRCm39) F575I possibly damaging Het
Ptpn13 G T 5: 103,713,091 (GRCm39) S1738I probably benign Het
Rnf126 G T 10: 79,595,057 (GRCm39) P269Q probably damaging Het
Ryr3 G A 2: 112,477,468 (GRCm39) probably benign Het
Slc2a7 C T 4: 150,233,978 (GRCm39) A31V probably damaging Het
Slc6a12 A G 6: 121,340,218 (GRCm39) D487G probably damaging Het
Son G T 16: 91,453,032 (GRCm39) G593V probably damaging Het
Spata31d1a T C 13: 59,850,964 (GRCm39) N388S probably benign Het
Spg11 A T 2: 121,922,668 (GRCm39) M927K possibly damaging Het
Taf13 A G 3: 108,479,038 (GRCm39) M1V probably null Het
Trim32 G A 4: 65,531,491 (GRCm39) R16Q probably damaging Het
Trio A G 15: 27,902,603 (GRCm39) F286S probably damaging Het
Trpm2 A C 10: 77,779,824 (GRCm39) probably benign Het
Ttc7b T C 12: 100,353,438 (GRCm39) M390V possibly damaging Het
Vmn1r184 A T 7: 25,966,968 (GRCm39) Q238L probably damaging Het
Zfp236 T C 18: 82,676,213 (GRCm39) E368G probably damaging Het
Zfr2 G T 10: 81,087,170 (GRCm39) probably benign Het
Other mutations in Lrpprc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Lrpprc APN 17 85,057,953 (GRCm39) missense possibly damaging 0.91
IGL01319:Lrpprc APN 17 85,012,840 (GRCm39) utr 3 prime probably benign
IGL01380:Lrpprc APN 17 85,030,158 (GRCm39) missense probably benign
IGL01560:Lrpprc APN 17 85,015,547 (GRCm39) missense probably benign 0.07
IGL01582:Lrpprc APN 17 85,061,971 (GRCm39) missense probably null 0.00
IGL01996:Lrpprc APN 17 85,080,698 (GRCm39) missense probably benign
IGL02109:Lrpprc APN 17 85,033,998 (GRCm39) nonsense probably null
IGL02163:Lrpprc APN 17 85,060,900 (GRCm39) missense probably damaging 0.97
IGL02248:Lrpprc APN 17 85,078,895 (GRCm39) missense probably damaging 0.99
IGL02503:Lrpprc APN 17 85,033,767 (GRCm39) missense probably benign
IGL02545:Lrpprc APN 17 85,082,853 (GRCm39) missense probably benign
IGL02570:Lrpprc APN 17 85,057,981 (GRCm39) missense probably damaging 1.00
IGL02636:Lrpprc APN 17 85,060,532 (GRCm39) unclassified probably benign
IGL02943:Lrpprc APN 17 85,078,878 (GRCm39) missense probably benign 0.00
IGL03008:Lrpprc APN 17 85,058,675 (GRCm39) missense probably benign 0.05
elusory UTSW 17 85,020,215 (GRCm39) missense probably benign 0.01
phantom UTSW 17 85,079,575 (GRCm39) missense probably damaging 1.00
R6807_Lrpprc_629 UTSW 17 85,056,531 (GRCm39) missense possibly damaging 0.93
Stereotype UTSW 17 85,074,483 (GRCm39) missense probably damaging 1.00
thus UTSW 17 85,078,355 (GRCm39) missense probably benign 0.01
P0023:Lrpprc UTSW 17 85,033,766 (GRCm39) missense probably benign 0.00
R0027:Lrpprc UTSW 17 85,074,435 (GRCm39) nonsense probably null
R0027:Lrpprc UTSW 17 85,074,435 (GRCm39) nonsense probably null
R0389:Lrpprc UTSW 17 85,060,540 (GRCm39) critical splice donor site probably null
R0448:Lrpprc UTSW 17 85,078,322 (GRCm39) missense probably benign 0.09
R1396:Lrpprc UTSW 17 85,033,731 (GRCm39) missense possibly damaging 0.68
R1759:Lrpprc UTSW 17 85,047,509 (GRCm39) missense probably damaging 1.00
R2019:Lrpprc UTSW 17 85,059,759 (GRCm39) missense possibly damaging 0.56
R2169:Lrpprc UTSW 17 85,077,505 (GRCm39) missense probably benign 0.00
R2312:Lrpprc UTSW 17 85,080,686 (GRCm39) missense probably damaging 0.96
R2319:Lrpprc UTSW 17 85,033,818 (GRCm39) missense probably benign
R2568:Lrpprc UTSW 17 85,034,077 (GRCm39) missense probably damaging 1.00
R3013:Lrpprc UTSW 17 85,074,497 (GRCm39) missense probably benign 0.04
R3620:Lrpprc UTSW 17 85,077,452 (GRCm39) missense probably benign 0.01
R3789:Lrpprc UTSW 17 85,078,956 (GRCm39) missense probably benign 0.25
R3848:Lrpprc UTSW 17 85,078,355 (GRCm39) missense probably benign 0.01
R3973:Lrpprc UTSW 17 85,078,269 (GRCm39) critical splice donor site probably null
R4111:Lrpprc UTSW 17 85,033,766 (GRCm39) missense probably benign 0.00
R4164:Lrpprc UTSW 17 85,038,617 (GRCm39) missense possibly damaging 0.47
R4331:Lrpprc UTSW 17 85,047,970 (GRCm39) critical splice donor site probably null
R4531:Lrpprc UTSW 17 85,020,215 (GRCm39) missense probably benign 0.01
R4832:Lrpprc UTSW 17 85,014,584 (GRCm39) missense probably benign 0.24
R4947:Lrpprc UTSW 17 85,078,966 (GRCm39) missense probably benign 0.02
R5134:Lrpprc UTSW 17 85,058,684 (GRCm39) missense probably benign 0.00
R5333:Lrpprc UTSW 17 85,097,821 (GRCm39) missense probably benign 0.01
R5950:Lrpprc UTSW 17 85,047,598 (GRCm39) missense possibly damaging 0.86
R5972:Lrpprc UTSW 17 85,020,250 (GRCm39) missense possibly damaging 0.88
R6185:Lrpprc UTSW 17 85,074,452 (GRCm39) missense probably benign
R6253:Lrpprc UTSW 17 85,048,065 (GRCm39) missense probably benign 0.00
R6488:Lrpprc UTSW 17 85,058,781 (GRCm39) missense probably damaging 1.00
R6807:Lrpprc UTSW 17 85,056,531 (GRCm39) missense possibly damaging 0.93
R6911:Lrpprc UTSW 17 85,063,711 (GRCm39) missense possibly damaging 0.67
R6933:Lrpprc UTSW 17 85,030,131 (GRCm39) missense probably benign 0.42
R6955:Lrpprc UTSW 17 85,084,417 (GRCm39) missense probably damaging 0.98
R7448:Lrpprc UTSW 17 85,079,567 (GRCm39) missense probably damaging 0.99
R7727:Lrpprc UTSW 17 85,084,375 (GRCm39) missense probably benign 0.00
R8003:Lrpprc UTSW 17 85,059,745 (GRCm39) missense probably benign 0.01
R8178:Lrpprc UTSW 17 85,079,575 (GRCm39) missense probably damaging 1.00
R8310:Lrpprc UTSW 17 85,080,524 (GRCm39) missense probably damaging 1.00
R8322:Lrpprc UTSW 17 85,047,496 (GRCm39) critical splice donor site probably null
R8389:Lrpprc UTSW 17 85,080,742 (GRCm39) missense possibly damaging 0.79
R8560:Lrpprc UTSW 17 85,047,495 (GRCm39) splice site probably benign
R8777:Lrpprc UTSW 17 85,058,657 (GRCm39) missense probably benign 0.30
R8777-TAIL:Lrpprc UTSW 17 85,058,657 (GRCm39) missense probably benign 0.30
R8868:Lrpprc UTSW 17 85,078,920 (GRCm39) missense probably damaging 0.99
R8970:Lrpprc UTSW 17 85,074,483 (GRCm39) missense probably damaging 1.00
R9042:Lrpprc UTSW 17 85,059,736 (GRCm39) critical splice donor site probably null
R9493:Lrpprc UTSW 17 85,015,548 (GRCm39) missense probably damaging 0.99
R9664:Lrpprc UTSW 17 85,020,262 (GRCm39) missense probably damaging 0.99
X0026:Lrpprc UTSW 17 85,018,090 (GRCm39) missense probably benign 0.42
Z1088:Lrpprc UTSW 17 85,077,928 (GRCm39) critical splice acceptor site probably null
Z1088:Lrpprc UTSW 17 85,039,212 (GRCm39) nonsense probably null
Z1176:Lrpprc UTSW 17 85,077,859 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ACGAATAAATCTGAGCCTGGTCTGC -3'
(R):5'- AAGAAGCCTCTGGCTTTCCGTGTC -3'

Sequencing Primer
(F):5'- GGATTAGCAACTTTACACCCAGG -3'
(R):5'- CTCTTAAGTGTGTAATGCCATCAG -3'
Posted On 2013-04-16