Incidental Mutation 'R2403:Ascc1'
ID248826
Institutional Source Beutler Lab
Gene Symbol Ascc1
Ensembl Gene ENSMUSG00000044475
Gene Nameactivating signal cointegrator 1 complex subunit 1
Synonyms1810015P09Rik, ASC1p50, CGI-18
MMRRC Submission 040369-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.719) question?
Stock #R2403 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location60002805-60099988 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60004841 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 8 (I8T)
Ref Sequence ENSEMBL: ENSMUSP00000126301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020307] [ENSMUST00000050516] [ENSMUST00000164083] [ENSMUST00000182116] [ENSMUST00000182152] [ENSMUST00000182898] [ENSMUST00000182912]
Predicted Effect probably benign
Transcript: ENSMUST00000020307
SMART Domains Protein: ENSMUSP00000020307
Gene: ENSMUSG00000020107

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000050516
AA Change: I8T

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000052351
Gene: ENSMUSG00000044475
AA Change: I8T

DomainStartEndE-ValueType
KH 56 124 9.05e-6 SMART
Pfam:AKAP7_NLS 132 355 4.3e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164083
AA Change: I8T

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000126301
Gene: ENSMUSG00000044475
AA Change: I8T

DomainStartEndE-ValueType
KH 56 124 9.05e-6 SMART
Pfam:AKAP7_NLS 132 355 3e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182116
Predicted Effect probably benign
Transcript: ENSMUST00000182152
SMART Domains Protein: ENSMUSP00000138579
Gene: ENSMUSG00000020107

DomainStartEndE-ValueType
low complexity region 21 45 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182898
SMART Domains Protein: ENSMUSP00000138112
Gene: ENSMUSG00000020107

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182912
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219778
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the activating signal cointegrator 1 (ASC-1) complex. The ASC-1 complex is a transcriptional coactivator that plays an important role in gene transactivation by multiple transcription factors including activating protein 1 (AP-1), nuclear factor kappa-B (NF-kB) and serum response factor (SRF). The encoded protein contains an N-terminal KH-type RNA-binding motif which is required for AP-1 transactivation by the ASC-1 complex. Mutations in this gene are associated with Barrett esophagus and esophageal adenocarcinoma. Alternatively spliced transcripts encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,170,943 E925G probably damaging Het
Abca9 T G 11: 110,115,454 Q1275P probably benign Het
Adgrl1 T A 8: 83,931,241 M492K probably benign Het
Ankrd50 T A 3: 38,483,085 K3* probably null Het
Arl5b T C 2: 15,075,037 S140P probably damaging Het
Armc1 T C 3: 19,157,676 probably benign Het
Bche A G 3: 73,701,472 V207A probably damaging Het
Cacna2d3 A G 14: 28,905,302 L1080P probably benign Het
Ceacam3 C A 7: 17,161,854 A583D probably damaging Het
Cep290 C T 10: 100,537,437 A1193V probably benign Het
Clcn1 T C 6: 42,313,112 I827T probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col28a1 T C 6: 8,175,641 D69G possibly damaging Het
Cts3 A G 13: 61,564,992 W305R probably damaging Het
Dmwd T C 7: 19,081,159 I578T possibly damaging Het
Dnmt3a G A 12: 3,899,883 V559M probably damaging Het
Dysf T C 6: 84,039,567 V70A possibly damaging Het
Eml6 A G 11: 29,802,434 V993A probably benign Het
Etl4 T A 2: 20,807,306 L1768* probably null Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fat3 T G 9: 15,969,871 D3235A probably damaging Het
Fbxo36 T A 1: 84,900,102 F162I probably damaging Het
Fgfrl1 T C 5: 108,705,031 W200R probably damaging Het
Fsip2 T C 2: 82,980,720 M2461T possibly damaging Het
Fut1 A G 7: 45,619,219 Y144C probably benign Het
Gprin3 G A 6: 59,354,149 A391V probably benign Het
H2-Q4 A G 17: 35,379,997 E81G probably damaging Het
Hacd3 A G 9: 65,001,029 S162P probably damaging Het
Itga1 A T 13: 114,977,614 H918Q probably benign Het
Lrp5 C A 19: 3,597,430 D1271Y probably damaging Het
Lsm8 C T 6: 18,849,644 T17I probably benign Het
Mup4 T A 4: 59,958,145 D141V probably damaging Het
Nckap5 G A 1: 126,027,409 H405Y probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr361 T C 2: 37,084,974 Y258C probably benign Het
Ostf1 T C 19: 18,584,662 K190R probably benign Het
Pnldc1 A T 17: 12,899,890 V197E probably damaging Het
Ptprc A G 1: 138,088,532 S531P probably damaging Het
Ryr3 C T 2: 112,686,628 E3318K probably damaging Het
Scamp2 T C 9: 57,577,712 V67A possibly damaging Het
Serpina3g C A 12: 104,241,162 L195M probably damaging Het
Siglec1 G T 2: 131,074,475 T1185N possibly damaging Het
Sycp2 G A 2: 178,403,735 Q31* probably null Het
Tmprss15 T G 16: 79,057,690 T277P probably damaging Het
Trim34b C T 7: 104,329,669 S41L probably benign Het
Ttn T C 2: 76,727,361 T21507A possibly damaging Het
Umad1 T C 6: 8,427,161 V138A possibly damaging Het
Zfp523 A G 17: 28,195,209 I72M probably damaging Het
Zfp655 C T 5: 145,244,546 R405C probably benign Het
Zfp715 G A 7: 43,299,268 R423C possibly damaging Het
Other mutations in Ascc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01403:Ascc1 APN 10 60012458 splice site probably benign
Dagger UTSW 10 60013653 missense probably damaging 1.00
stiletto UTSW 10 60004819 start codon destroyed probably damaging 1.00
R1307:Ascc1 UTSW 10 60012499 missense probably benign 0.00
R1463:Ascc1 UTSW 10 60062516 missense probably benign 0.17
R4308:Ascc1 UTSW 10 60013612 missense probably benign 0.00
R4703:Ascc1 UTSW 10 60049802 missense probably damaging 1.00
R4704:Ascc1 UTSW 10 60049802 missense probably damaging 1.00
R4705:Ascc1 UTSW 10 60049802 missense probably damaging 1.00
R4916:Ascc1 UTSW 10 60004862 missense probably benign 0.01
R6906:Ascc1 UTSW 10 60004852 missense probably benign 0.01
R6944:Ascc1 UTSW 10 60013653 missense probably damaging 1.00
R7227:Ascc1 UTSW 10 60007738 missense probably benign 0.08
R7661:Ascc1 UTSW 10 60049807 missense probably damaging 1.00
R7766:Ascc1 UTSW 10 60004819 start codon destroyed probably damaging 1.00
R7940:Ascc1 UTSW 10 60012559 missense probably null 1.00
R8104:Ascc1 UTSW 10 60007729 missense probably benign
Z1176:Ascc1 UTSW 10 60007793 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- CTACTTGCCTACATAATGGAGTTTC -3'
(R):5'- TTTATTAGACCCACTGAGCAGC -3'

Sequencing Primer
(F):5'- GACAACCTGCAGGAGTCAACTTTTTC -3'
(R):5'- TGAGCAGCAACAAAGCAAAGAATTAC -3'
Posted On2014-11-11