Incidental Mutation 'R2403:Cacna2d3'
ID 248836
Institutional Source Beutler Lab
Gene Symbol Cacna2d3
Ensembl Gene ENSMUSG00000021991
Gene Name calcium channel, voltage-dependent, alpha2/delta subunit 3
Synonyms alpha 2 delta-3, alpha2delta3
MMRRC Submission 040369-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2403 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 28626900-29443821 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 28627259 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 1080 (L1080P)
Ref Sequence ENSEMBL: ENSMUSP00000022567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022567] [ENSMUST00000225668] [ENSMUST00000225985]
AlphaFold Q9Z1L5
Predicted Effect probably benign
Transcript: ENSMUST00000022567
AA Change: L1080P

PolyPhen 2 Score 0.385 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000022567
Gene: ENSMUSG00000021991
AA Change: L1080P

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
Blast:WNT1 28 103 2e-33 BLAST
Pfam:VWA_N 113 229 6.8e-40 PFAM
VWA 254 439 4.13e-24 SMART
Pfam:Cache_1 452 548 3e-32 PFAM
low complexity region 1070 1088 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000225668
Predicted Effect unknown
Transcript: ENSMUST00000225985
AA Change: L253P
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the alpha-2/delta subunit family, a protein in the voltage-dependent calcium channel complex. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. Research on a highly similar protein in rabbit suggests the protein described in this record is cleaved into alpha-2 and delta subunits. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have a decreased startle reflex and occasional animals show increased aggression and hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 121,964,592 (GRCm39) E925G probably damaging Het
Abca9 T G 11: 110,006,280 (GRCm39) Q1275P probably benign Het
Adgrl1 T A 8: 84,657,870 (GRCm39) M492K probably benign Het
Ankrd50 T A 3: 38,537,234 (GRCm39) K3* probably null Het
Arl5b T C 2: 15,079,848 (GRCm39) S140P probably damaging Het
Armc1 T C 3: 19,211,840 (GRCm39) probably benign Het
Ascc1 T C 10: 59,840,663 (GRCm39) I8T probably benign Het
Bche A G 3: 73,608,805 (GRCm39) V207A probably damaging Het
Ceacam3 C A 7: 16,895,779 (GRCm39) A583D probably damaging Het
Cep290 C T 10: 100,373,299 (GRCm39) A1193V probably benign Het
Clcn1 T C 6: 42,290,046 (GRCm39) I827T probably damaging Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Col28a1 T C 6: 8,175,641 (GRCm39) D69G possibly damaging Het
Cts3 A G 13: 61,712,806 (GRCm39) W305R probably damaging Het
Dmwd T C 7: 18,815,084 (GRCm39) I578T possibly damaging Het
Dnmt3a G A 12: 3,949,883 (GRCm39) V559M probably damaging Het
Dysf T C 6: 84,016,549 (GRCm39) V70A possibly damaging Het
Eml6 A G 11: 29,752,434 (GRCm39) V993A probably benign Het
Etl4 T A 2: 20,812,117 (GRCm39) L1768* probably null Het
F11 A G 8: 45,701,675 (GRCm39) S353P probably damaging Het
Fat3 T G 9: 15,881,167 (GRCm39) D3235A probably damaging Het
Fbxo36 T A 1: 84,877,823 (GRCm39) F162I probably damaging Het
Fgfrl1 T C 5: 108,852,897 (GRCm39) W200R probably damaging Het
Fsip2 T C 2: 82,811,064 (GRCm39) M2461T possibly damaging Het
Fut1 A G 7: 45,268,643 (GRCm39) Y144C probably benign Het
Gprin3 G A 6: 59,331,134 (GRCm39) A391V probably benign Het
H2-Q4 A G 17: 35,598,973 (GRCm39) E81G probably damaging Het
Hacd3 A G 9: 64,908,311 (GRCm39) S162P probably damaging Het
Itga1 A T 13: 115,114,150 (GRCm39) H918Q probably benign Het
Lrp5 C A 19: 3,647,430 (GRCm39) D1271Y probably damaging Het
Lsm8 C T 6: 18,849,643 (GRCm39) T17I probably benign Het
Mup4 T A 4: 59,958,145 (GRCm39) D141V probably damaging Het
Nckap5 G A 1: 125,955,146 (GRCm39) H405Y probably benign Het
Obscn T C 11: 59,022,472 (GRCm39) R758G possibly damaging Het
Or12k8 T C 2: 36,974,986 (GRCm39) Y258C probably benign Het
Ostf1 T C 19: 18,562,026 (GRCm39) K190R probably benign Het
Pnldc1 A T 17: 13,118,777 (GRCm39) V197E probably damaging Het
Ptprc A G 1: 138,016,270 (GRCm39) S531P probably damaging Het
Ryr3 C T 2: 112,516,973 (GRCm39) E3318K probably damaging Het
Scamp2 T C 9: 57,484,995 (GRCm39) V67A possibly damaging Het
Serpina3g C A 12: 104,207,421 (GRCm39) L195M probably damaging Het
Siglec1 G T 2: 130,916,395 (GRCm39) T1185N possibly damaging Het
Sycp2 G A 2: 178,045,528 (GRCm39) Q31* probably null Het
Tmprss15 T G 16: 78,854,578 (GRCm39) T277P probably damaging Het
Trim34b C T 7: 103,978,876 (GRCm39) S41L probably benign Het
Ttn T C 2: 76,557,705 (GRCm39) T21507A possibly damaging Het
Umad1 T C 6: 8,427,161 (GRCm39) V138A possibly damaging Het
Zfp523 A G 17: 28,414,183 (GRCm39) I72M probably damaging Het
Zfp655 C T 5: 145,181,356 (GRCm39) R405C probably benign Het
Zfp715 G A 7: 42,948,692 (GRCm39) R423C possibly damaging Het
Other mutations in Cacna2d3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Cacna2d3 APN 14 29,022,688 (GRCm39) splice site probably benign
IGL01150:Cacna2d3 APN 14 28,905,598 (GRCm39) missense possibly damaging 0.95
IGL01390:Cacna2d3 APN 14 28,665,548 (GRCm39) missense possibly damaging 0.91
IGL01626:Cacna2d3 APN 14 28,665,564 (GRCm39) missense possibly damaging 0.90
IGL02127:Cacna2d3 APN 14 28,785,832 (GRCm39) unclassified probably benign
IGL02237:Cacna2d3 APN 14 29,068,954 (GRCm39) missense probably benign 0.09
IGL02274:Cacna2d3 APN 14 28,678,827 (GRCm39) splice site probably null
IGL02604:Cacna2d3 APN 14 29,015,066 (GRCm39) missense possibly damaging 0.61
IGL02806:Cacna2d3 APN 14 29,073,907 (GRCm39) splice site probably null
IGL02838:Cacna2d3 APN 14 29,022,785 (GRCm39) critical splice acceptor site probably null
IGL02894:Cacna2d3 APN 14 28,786,276 (GRCm39) critical splice acceptor site probably null
IGL03061:Cacna2d3 APN 14 28,780,388 (GRCm39) missense probably damaging 0.98
IGL03117:Cacna2d3 APN 14 29,189,909 (GRCm39) missense probably damaging 1.00
IGL03265:Cacna2d3 APN 14 28,674,243 (GRCm39) missense probably damaging 0.98
IGL03266:Cacna2d3 APN 14 29,022,705 (GRCm39) missense probably benign 0.01
IGL03396:Cacna2d3 APN 14 29,442,834 (GRCm39) nonsense probably null
R0094:Cacna2d3 UTSW 14 28,892,460 (GRCm39) critical splice donor site probably null
R0326:Cacna2d3 UTSW 14 28,767,601 (GRCm39) missense probably damaging 0.96
R0485:Cacna2d3 UTSW 14 29,256,476 (GRCm39) missense possibly damaging 0.89
R0669:Cacna2d3 UTSW 14 29,189,906 (GRCm39) missense probably benign 0.40
R0730:Cacna2d3 UTSW 14 28,704,322 (GRCm39) missense probably benign 0.02
R0736:Cacna2d3 UTSW 14 28,780,585 (GRCm39) missense probably benign 0.02
R1073:Cacna2d3 UTSW 14 28,767,580 (GRCm39) missense probably damaging 0.99
R1116:Cacna2d3 UTSW 14 28,786,278 (GRCm39) splice site probably benign
R1312:Cacna2d3 UTSW 14 28,767,625 (GRCm39) missense probably benign 0.00
R1467:Cacna2d3 UTSW 14 29,055,736 (GRCm39) missense possibly damaging 0.67
R1467:Cacna2d3 UTSW 14 29,055,736 (GRCm39) missense possibly damaging 0.67
R1501:Cacna2d3 UTSW 14 28,703,137 (GRCm39) missense probably damaging 1.00
R1525:Cacna2d3 UTSW 14 28,694,199 (GRCm39) missense probably benign 0.01
R1574:Cacna2d3 UTSW 14 29,073,779 (GRCm39) missense probably damaging 1.00
R1574:Cacna2d3 UTSW 14 29,073,779 (GRCm39) missense probably damaging 1.00
R1866:Cacna2d3 UTSW 14 28,691,171 (GRCm39) missense probably damaging 1.00
R2981:Cacna2d3 UTSW 14 28,785,875 (GRCm39) missense probably damaging 1.00
R3715:Cacna2d3 UTSW 14 29,068,880 (GRCm39) missense probably damaging 1.00
R3791:Cacna2d3 UTSW 14 28,905,538 (GRCm39) missense probably benign 0.03
R3847:Cacna2d3 UTSW 14 29,069,077 (GRCm39) critical splice donor site probably null
R3849:Cacna2d3 UTSW 14 29,069,077 (GRCm39) critical splice donor site probably null
R3850:Cacna2d3 UTSW 14 29,069,077 (GRCm39) critical splice donor site probably null
R4558:Cacna2d3 UTSW 14 28,825,670 (GRCm39) missense possibly damaging 0.70
R4594:Cacna2d3 UTSW 14 28,704,303 (GRCm39) missense probably benign 0.13
R4681:Cacna2d3 UTSW 14 29,015,092 (GRCm39) missense probably damaging 1.00
R4868:Cacna2d3 UTSW 14 28,678,743 (GRCm39) splice site probably null
R4965:Cacna2d3 UTSW 14 28,704,289 (GRCm39) missense probably benign 0.07
R5133:Cacna2d3 UTSW 14 29,015,135 (GRCm39) missense possibly damaging 0.75
R5311:Cacna2d3 UTSW 14 29,068,987 (GRCm39) missense probably damaging 0.99
R5432:Cacna2d3 UTSW 14 28,665,512 (GRCm39) critical splice donor site probably null
R5873:Cacna2d3 UTSW 14 29,442,891 (GRCm39) missense probably benign 0.31
R6103:Cacna2d3 UTSW 14 29,118,446 (GRCm39) missense probably damaging 1.00
R6197:Cacna2d3 UTSW 14 28,630,278 (GRCm39) missense probably benign 0.38
R6396:Cacna2d3 UTSW 14 29,118,522 (GRCm39) missense probably benign 0.03
R6626:Cacna2d3 UTSW 14 28,786,143 (GRCm39) unclassified probably benign
R6632:Cacna2d3 UTSW 14 28,627,222 (GRCm39) makesense probably null
R6706:Cacna2d3 UTSW 14 28,846,642 (GRCm39) critical splice acceptor site probably null
R6765:Cacna2d3 UTSW 14 28,777,934 (GRCm39) missense probably damaging 1.00
R6945:Cacna2d3 UTSW 14 28,691,275 (GRCm39) intron probably benign
R7009:Cacna2d3 UTSW 14 28,691,322 (GRCm39) start codon destroyed probably null
R7069:Cacna2d3 UTSW 14 28,691,260 (GRCm39) intron probably benign
R7146:Cacna2d3 UTSW 14 29,443,654 (GRCm39) missense unknown
R7427:Cacna2d3 UTSW 14 28,786,232 (GRCm39) missense probably damaging 1.00
R7428:Cacna2d3 UTSW 14 28,786,232 (GRCm39) missense probably damaging 1.00
R7445:Cacna2d3 UTSW 14 28,780,575 (GRCm39) missense possibly damaging 0.88
R7505:Cacna2d3 UTSW 14 28,767,501 (GRCm39) splice site probably null
R7560:Cacna2d3 UTSW 14 28,780,378 (GRCm39) missense probably benign 0.18
R7703:Cacna2d3 UTSW 14 28,765,503 (GRCm39) missense possibly damaging 0.90
R8042:Cacna2d3 UTSW 14 28,826,995 (GRCm39) splice site probably benign
R8096:Cacna2d3 UTSW 14 28,825,657 (GRCm39) missense possibly damaging 0.62
R8280:Cacna2d3 UTSW 14 28,704,328 (GRCm39) missense probably benign 0.25
R8814:Cacna2d3 UTSW 14 28,819,772 (GRCm39) missense probably damaging 1.00
R8838:Cacna2d3 UTSW 14 28,691,220 (GRCm39) missense probably benign 0.03
R8864:Cacna2d3 UTSW 14 29,055,735 (GRCm39) missense probably damaging 1.00
R9103:Cacna2d3 UTSW 14 29,068,971 (GRCm39) missense probably damaging 1.00
R9341:Cacna2d3 UTSW 14 28,704,315 (GRCm39) missense possibly damaging 0.92
R9343:Cacna2d3 UTSW 14 28,704,315 (GRCm39) missense possibly damaging 0.92
R9567:Cacna2d3 UTSW 14 28,627,268 (GRCm39) missense probably benign 0.38
Z1088:Cacna2d3 UTSW 14 28,786,265 (GRCm39) missense probably damaging 0.99
Z1177:Cacna2d3 UTSW 14 29,069,120 (GRCm39) missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- CACATTTGCATGACTGGCAAAG -3'
(R):5'- GACAAATCCGTGTCCTTCCATC -3'

Sequencing Primer
(F):5'- CTGTTAGAGTTTCTATCACGCACAG -3'
(R):5'- TTCCATCGCTGAGTCAGAAG -3'
Posted On 2014-11-11