Incidental Mutation 'R2403:Zfp523'
ID248839
Institutional Source Beutler Lab
Gene Symbol Zfp523
Ensembl Gene ENSMUSG00000024220
Gene Namezinc finger protein 523
Synonyms
MMRRC Submission 040369-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.411) question?
Stock #R2403 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location28177207-28205886 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28195209 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 72 (I72M)
Ref Sequence ENSEMBL: ENSMUSP00000073226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002318] [ENSMUST00000073534] [ENSMUST00000133868]
Predicted Effect probably damaging
Transcript: ENSMUST00000002318
AA Change: I72M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000002318
Gene: ENSMUSG00000024220
AA Change: I72M

DomainStartEndE-ValueType
internal_repeat_1 7 45 7.42e-6 PROSPERO
internal_repeat_1 60 99 7.42e-6 PROSPERO
low complexity region 116 129 N/A INTRINSIC
ZnF_C2H2 165 189 7.15e-2 SMART
ZnF_C2H2 195 219 3.16e-3 SMART
ZnF_C2H2 225 249 8.47e-4 SMART
ZnF_C2H2 255 279 2.24e-3 SMART
ZnF_C2H2 285 309 3.44e-4 SMART
ZnF_C2H2 315 339 1.69e-3 SMART
ZnF_C2H2 345 368 5.06e-2 SMART
low complexity region 375 396 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000073534
AA Change: I72M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073226
Gene: ENSMUSG00000024220
AA Change: I72M

DomainStartEndE-ValueType
internal_repeat_1 7 45 7.42e-6 PROSPERO
internal_repeat_1 60 99 7.42e-6 PROSPERO
low complexity region 116 129 N/A INTRINSIC
ZnF_C2H2 165 189 7.15e-2 SMART
ZnF_C2H2 195 219 3.16e-3 SMART
ZnF_C2H2 225 249 8.47e-4 SMART
ZnF_C2H2 255 279 2.24e-3 SMART
ZnF_C2H2 285 309 3.44e-4 SMART
ZnF_C2H2 315 339 1.69e-3 SMART
ZnF_C2H2 345 368 5.06e-2 SMART
low complexity region 375 396 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133868
SMART Domains Protein: ENSMUSP00000123127
Gene: ENSMUSG00000024220

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
ZnF_C2H2 84 108 7.15e-2 SMART
ZnF_C2H2 114 138 3.16e-3 SMART
ZnF_C2H2 144 168 8.47e-4 SMART
ZnF_C2H2 174 198 3.44e-4 SMART
ZnF_C2H2 204 228 1.69e-3 SMART
ZnF_C2H2 234 257 5.06e-2 SMART
low complexity region 264 285 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145313
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161275
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,170,943 E925G probably damaging Het
Abca9 T G 11: 110,115,454 Q1275P probably benign Het
Adgrl1 T A 8: 83,931,241 M492K probably benign Het
Ankrd50 T A 3: 38,483,085 K3* probably null Het
Arl5b T C 2: 15,075,037 S140P probably damaging Het
Armc1 T C 3: 19,157,676 probably benign Het
Ascc1 T C 10: 60,004,841 I8T probably benign Het
Bche A G 3: 73,701,472 V207A probably damaging Het
Cacna2d3 A G 14: 28,905,302 L1080P probably benign Het
Ceacam3 C A 7: 17,161,854 A583D probably damaging Het
Cep290 C T 10: 100,537,437 A1193V probably benign Het
Clcn1 T C 6: 42,313,112 I827T probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col28a1 T C 6: 8,175,641 D69G possibly damaging Het
Cts3 A G 13: 61,564,992 W305R probably damaging Het
Dmwd T C 7: 19,081,159 I578T possibly damaging Het
Dnmt3a G A 12: 3,899,883 V559M probably damaging Het
Dysf T C 6: 84,039,567 V70A possibly damaging Het
Eml6 A G 11: 29,802,434 V993A probably benign Het
Etl4 T A 2: 20,807,306 L1768* probably null Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fat3 T G 9: 15,969,871 D3235A probably damaging Het
Fbxo36 T A 1: 84,900,102 F162I probably damaging Het
Fgfrl1 T C 5: 108,705,031 W200R probably damaging Het
Fsip2 T C 2: 82,980,720 M2461T possibly damaging Het
Fut1 A G 7: 45,619,219 Y144C probably benign Het
Gprin3 G A 6: 59,354,149 A391V probably benign Het
H2-Q4 A G 17: 35,379,997 E81G probably damaging Het
Hacd3 A G 9: 65,001,029 S162P probably damaging Het
Itga1 A T 13: 114,977,614 H918Q probably benign Het
Lrp5 C A 19: 3,597,430 D1271Y probably damaging Het
Lsm8 C T 6: 18,849,644 T17I probably benign Het
Mup4 T A 4: 59,958,145 D141V probably damaging Het
Nckap5 G A 1: 126,027,409 H405Y probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr361 T C 2: 37,084,974 Y258C probably benign Het
Ostf1 T C 19: 18,584,662 K190R probably benign Het
Pnldc1 A T 17: 12,899,890 V197E probably damaging Het
Ptprc A G 1: 138,088,532 S531P probably damaging Het
Ryr3 C T 2: 112,686,628 E3318K probably damaging Het
Scamp2 T C 9: 57,577,712 V67A possibly damaging Het
Serpina3g C A 12: 104,241,162 L195M probably damaging Het
Siglec1 G T 2: 131,074,475 T1185N possibly damaging Het
Sycp2 G A 2: 178,403,735 Q31* probably null Het
Tmprss15 T G 16: 79,057,690 T277P probably damaging Het
Trim34b C T 7: 104,329,669 S41L probably benign Het
Ttn T C 2: 76,727,361 T21507A possibly damaging Het
Umad1 T C 6: 8,427,161 V138A possibly damaging Het
Zfp655 C T 5: 145,244,546 R405C probably benign Het
Zfp715 G A 7: 43,299,268 R423C possibly damaging Het
Other mutations in Zfp523
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Zfp523 APN 17 28201049 missense possibly damaging 0.95
IGL01405:Zfp523 APN 17 28204506 missense probably damaging 0.99
IGL02430:Zfp523 APN 17 28195139 unclassified probably benign
R0496:Zfp523 UTSW 17 28200445 missense possibly damaging 0.83
R1533:Zfp523 UTSW 17 28204499 missense probably benign 0.18
R1837:Zfp523 UTSW 17 28194993 missense probably damaging 0.99
R1838:Zfp523 UTSW 17 28194993 missense probably damaging 0.99
R1839:Zfp523 UTSW 17 28194993 missense probably damaging 0.99
R2023:Zfp523 UTSW 17 28201004 unclassified probably benign
R2104:Zfp523 UTSW 17 28195216 missense probably benign 0.31
R2864:Zfp523 UTSW 17 28202540 missense probably benign 0.00
R4157:Zfp523 UTSW 17 28202283 missense probably benign 0.06
R4214:Zfp523 UTSW 17 28201029 missense probably benign 0.04
R4771:Zfp523 UTSW 17 28201338 splice site probably null
R5869:Zfp523 UTSW 17 28194993 missense probably benign 0.37
R5950:Zfp523 UTSW 17 28202558 missense probably benign 0.06
R6443:Zfp523 UTSW 17 28201407 missense probably damaging 0.99
R6679:Zfp523 UTSW 17 28202220 missense probably damaging 1.00
R6694:Zfp523 UTSW 17 28200472 missense probably damaging 1.00
R7669:Zfp523 UTSW 17 28201041 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTACATTCACCAGGTGACGATAC -3'
(R):5'- TGGTGTGACAAGGTACCAGC -3'

Sequencing Primer
(F):5'- CATTCACCAGGTGACGATACAGAAAG -3'
(R):5'- GCACCTACGCTGATGTCAAG -3'
Posted On2014-11-11